Results from Contest # 252 [December 30, 2007 - 178 entries]
 |
 |
PUPsicle. [votes: 50] |
Pat |
 |
You have a little something on your chin. [votes: 44] |
Chris |
 |
5...4...3...2...1... Happy New Year!! (smooch) [votes: 33] |
Greggo |
|
Honorable Mentions
- Takes a lickin', keeps on tickin'. [votes: 26]
- I hate spit baths. [votes: 21]
- No tongues! NOOOOO tongues!! [votes: 14]
- Don't worry...I'm a trained professional. [votes: 12]
- One down, ten to go. [votes: 11]
- Who doesn't love the new year baby?! [votes: 11]
- Do you think this will get us on the internet? [votes: 11]
- Spot-checking. [votes: 10]
- I love you man! [votes: 9]
- Jack be nimble, jack be lick! [votes: 9]
- Curbside tongue service. [votes: 6]
- I don't know. Ask your mom. [votes: 3]
- I surrender!!!! [votes: 2]
|
Results from Contest # 251 [December 23, 2007 - 108 entries]
 |
 |
You vill NOT take zees tennis ball! Nein! Nein! [votes: 45] |
Kirie W |
 |
My human has too much time on his hands. [votes: 32] |
Pat |
 |
It's like eating a squirrel. Once you get the fur off, it's nice and chewy. [votes: 29] |
cred |
|
Honorable Mentions
- The hat gets returned, but I keep the ball! [votes: 21]
- Jack In The Hat. [votes: 20]
- My hat's too big and my mouth's too small! [votes: 20]
- Yes, I Drink Alone! [votes: 13]
- Couches, tennis balls and Harley Davidson hats, these are a few of my favorite things. [votes: 13]
- Are you sure this is gonna impress the judges???? [votes: 11]
- Why do people think this is so funny? [votes: 9]
- Open mouth, insert ball. [votes: 9]
- Has the ball dropped yet? [votes: 9]
- Newest member of the "Jacks of Columbus". [votes: 7]
- Back away, there is nothing to see here. [votes: 6]
- I wear this so they can spot me in the snow. [votes: 4]
|
Results from Contest # 250 [December 16, 2007 - 190 entries]
 |
 |
This means she gave the baby my chew toy again. I hate when she loses her glasses! [votes: 66] |
cred |
 |
If you think this is gonna shut me up you are so wrong. [votes: 43] |
Bevansley |
 |
Yeah I took it from the kid and not giving it back. [votes: 27] |
anon |
|
Honorable Mentions
- These thing'll never replace a good crunchy squirrel. [votes: 15]
- Silence of the Jacks. [votes: 13]
- And poor Jack needed therapy the rest of his life. [votes: 12]
- Dude, the cat is laughing at me. [votes: 12]
- Yelp control. [votes: 11]
- Got binky? [votes: 8]
- What she doesn't know, is that I just destroyed her shoe. [votes: 7]
- This is no way to break my chipmunk habit. [votes: 7]
- This dingo ate your baby! [votes: 7]
- Please don't take my binnky. [votes: 5]
- I better knock it off. I'm gonna have an overbite!!! [votes: 5]
- Jack love his binky. [votes: 3]
- Preparing for the baby. [votes: 2]
- Please save me! Please! [votes: 2]
- Nobody puts baby in the corner! [votes: 2]
- 21 Seconds to a Pacified Dog. [votes: 2]
|
Results from Contest # 249 [December 9, 2007 - 266 entries]
 |
 |
Santa's little YELPER. [votes: 48] |
Pat |
 |
Reason 101 why animals attack during the holidays. [votes: 34] |
Mandy |
 |
Clearly, Jack has been spending too much time at elfyourself.com. [votes: 25] |
vicki |
|
Honorable Mentions
- This is as jolly as I'm gonna get! [votes: 23]
- HOHOHO! I left a nice gift under the tree. [votes: 21]
- I ate the naughty list, because my name was on it. [votes: 19]
- Yeah, I ate an elf...so what? [votes: 18]
- This is elfin embarrassing. [votes: 17]
- I'm only doing this for the presents! [votes: 16]
- Hand over the cookies or the Fat man gets it. [votes: 12]
- All I want for christmas is for it to be OVER... [votes: 12]
- I'm one of Oprah's favorite things! [votes: 7]
- OH YEAH,... I'M KEEPING A LIST... [votes: 7]
- I make this look cool. [votes: 6]
- Elves taste good with ketchup. [votes: 6]
- I've been a baad elf! [votes: 6]
- Jack makes an elf of himself. [votes: 6]
- Hermey wants to be a dentist... [votes: 6]
- I have the sense people are staring at me this moment... [votes: 4]
- Pssst....I've got the keys to the sleigh tonight. [votes: 3]
- All I want for Chistmas is a cat in my teeth! [votes: 3]
- Ho, Ho, Hole!!!! [votes: 2]
- Don't mess with the elf! [votes: 1]
- How about a little elf magic? [votes: 1]
|
Results from Contest # 248 [December 2, 2007 - 223 entries]
 |
 |
I didn't do it! It was like that when I got here! [votes: 68] |
C |
 |
This chicken will not be crossing the road. [votes: 32] |
Debbie W |
 |
I killed it...You cook it. [votes: 28] |
Bevansley |
|
Honorable Mentions
- What am I supposed to do with this? [votes: 23]
- Mom, look what the cat dragged in! [votes: 15]
- We'll make the breast of it... [votes: 15]
- Okay, who's next? [votes: 15]
- Jack Be Nimble Jack Be Quick, Jack Didn't Know What To Do With The Chick. [votes: 14]
- May I ask what the chicken did? [votes: 14]
- Another one bites the dust. [votes: 11]
- That's mine, don't touch it. [votes: 9]
- Me thinks me killed the chicken, better not look. [votes: 9]
- Help, the chick has fallen and can't get up!! [votes: 8]
- Another boring banquet rubber chicken dinner! [votes: 8]
- Excuse me...I think the chicken has gone bad... [votes: 7]
- Waiter! Where's my bowl of Chardonnay? [votes: 5]
- Allow me to say a few words about the chicken. [votes: 5]
- The new BARF diet. [votes: 4]
- Chicken tonight! [votes: 1]
- Chicken......just the way I like it !! [votes: 1]
- My first go-to-ground win. [votes: 1]
|
Results from Contest # 247 [November 25, 2007 - 262 entries]
 |
 |
MOM!!!.... HE'S TOUCHING MEEEE!!!! [votes: 77] |
Sindy |
 |
I hope this isn't your favorite cat. [votes: 30] |
Doug |
 |
oh darn, witnesses... [votes: 25] |
jimmy |
|
Honorable Mentions
- That's it - blind me with the flash - just when I corner the cat? [votes: 20]
- OK, this is the last time I answer a personal ad! [votes: 20]
- Go to a happy place! Go to a happy place! Go to a happy place!! [votes: 18]
- Oh man....this wasn't supposed to be on camera! [votes: 16]
- I should have known, she's going right for the jewelry. [votes: 15]
- I like 'em to think they have a chance before I eat 'em. [votes: 15]
- Somebody please adopt me...NOW! [votes: 14]
- What did I do? [votes: 12]
- Jack knew right then that this relationship would never work out. [votes: 11]
- It's going to be one of those days. [votes: 10]
- What do you mean your mother is coming for the weekend? [votes: 8]
- Playing with my food. [votes: 7]
- When did my life take such a terrible turn? [votes: 6]
- Tabby was never seen again. [votes: 6]
- Did I thank you for my new Squeaky toy? [votes: 6]
- When good cats go bad. [votes: 5]
- Got Cat???? I do!!! [votes: 4]
|
Results from Contest # 246 [November 18, 2007 - 214 entries]
 |
 |
It's going to take a while to get the squeaker out of this one! [votes: 45] |
Vickie |
 |
Jack thought he better be nice to the new cat. [votes: 37] |
vickie |
 |
Keep smiling, they're almost gone. [votes: 31] |
Sarah M |
|
Honorable Mentions
- Wait for it...wait for it... [votes: 21]
- Jack Spratt could eat no fat; his wife could eat no lean. [votes: 21]
- Yeah I know Dad, she's not from around here. [votes: 18]
- I jump around constantly, what is your superpower? [votes: 17]
- I've got you babe. [votes: 16]
- One good reason to spay and neuter! [votes: 15]
- I hate when the frisbee goes over the fence. [votes: 14]
- When Harry met Not-So-Harry. [votes: 13]
- The boss is a need'n the 15 bones you owe him. [votes: 12]
- Your haircut looks really nice, hon. [votes: 10]
- Jack now regrets being the wingman. [votes: 7]
- I've heard of bed head, but this must be kennel head! [votes: 7]
- Give me your coat. [votes: 5]
- Look what I dug up. [votes: 5]
- Eskimo Jack visiting the lower 48. [votes: 4]
- Would you look at that.. [votes: 4]
|
Results from Contest # 245 [November 11, 2007 - 267 entries]
 |
 |
You're not as big as I think I am. [votes: 48] |
parker |
 |
Fox Hunt on Saturday? Count me in! [votes: 38] |
Divot |
 |
You gotta win tomorrow, I bet all my biscuits. [votes: 34] |
luanne |
|
Honorable Mentions
- "... and then I struck this pose, and won the show." [votes: 24]
- I'll get the gate, you take the blame, got it? Good. [votes: 21]
- Listen horse, big is all in the attitude! [votes: 21]
- If you are 50% white and can stand like this, I can get you in. [votes: 16]
- I'm Wilber, what your name? [votes: 15]
- The Horse Whisperer. [votes: 15]
- I thought I was the long legged, 50% white, smooth coat. [votes: 14]
- ... and there was this one time at band camp. [votes: 14]
- "Are you my mother?" "Neigh." [votes: 10]
- That's a mighty fine crate you have! [votes: 9]
- Lookin' for love in all the wrong places. [votes: 9]
- You must be an over! [votes: 7]
- I'm going to give you one more chance to tell the truth. Then it's going to get ugly. [votes: 7]
- One neighsayer didn't know Jack! [votes: 7]
- Howdy partner! [votes: 6]
- You had me at hello! [votes: 4]
- Yeah, I'm betting on you in the Derby. [votes: 3]
- How's the weather up there? [votes: 3]
- Are you thinking what I'm thinking? [votes: 1]
|
Results from Contest # 244 [November 4, 2007 - 203 entries]
 |
 |
Jacky plans his getaway from obedience class. |
Becky |
 |
Tour De Jack. [votes: 37] |
Gerry Hazelton |
 |
This agility training is just getting out of hand! [votes: 35] |
Matt Haring |
|
Honorable Mentions
- I never thought I'd be thanking God for being NEUTERED! [votes: 28]
- Must... catch... mailman! [votes: 25]
- Who put this junk on my beautiful dirt?? [votes: 20]
- This doesn't feel right. And I look stupid. [votes: 19]
- Too bad I chewed all the rubber of the tires, this would have been fun to ride. [votes: 15]
- THE COLLIES Are COMING... THE COLLIES ARE COMING ... [votes: 15]
- Whadaya mean it's a lawn ornament? [votes: 14]
- Easy Rider. [votes: 14]
- Let them heel -- I'm gonna WHEEL! [votes: 13]
- Two tires, and a splash of gas - Daytona "2008" here I come!!! [votes: 11]
- ooouch!! Aren't these things suppose to have seats?? [votes: 10]
- What do you mean they're still not looking? [votes: 10]
- Jack realized in horror that his bike may have been a rip off! [votes: 10]
- Gotta get away from all these shelties. [votes: 9]
- WHAT! no horn on it? [votes: 6]
- If I wanted to go in circles, I would have just chased my tail. [votes: 6]
- I run faster than I pedal... [votes: 5]
- Hey, this isn't my bike, mine moves. [votes: 5]
- Wow! I'm jealous it's 100% white. [votes: 4]
- Jack be nimble. [votes: 3]
- oops - I think I've split my difference! [votes: 3]
- Wheel meet again. [votes: 2]
- Jack's stationary bike. [votes: 1]
|
Results from Contest # 243 [October 28, 2007 - 267 entries]
 |
 |
If you think I am dirty, you should see the cat I'm standing on. [votes: 77] |
Bill He |
 |
The next thing you know 'ol Jack's a millionaire... [votes: 56] |
Clampett |
 |
I think I found your problem, lady. [votes: 50] |
Steve T |
|
Honorable Mentions
- I guess sleeping in the bed is out of the question. [votes: 31]
- What do you mean I need a bath? [votes: 29]
- Life is good. [votes: 21]
- Come on in; the water's fine! [votes: 16]
- Muddy Buddy. [votes: 16]
- Heaven!! [votes: 15]
- It puts the lotion on the skin! Or it gets the hose again! [votes: 15]
- Got Mud! [votes: 15]
- Jack fell down a well....but saw no reason to get out! [votes: 9]
- I think I went too far to ground. [votes: 8]
- I'm still 51% white. [votes: 7]
- Sometimes it's just too challenging to clean up after your dog. [votes: 6]
- I'm 17% white! [votes: 5]
- Going to Ground should be cancelled during the rainy season! [votes: 4]
- I hope this is mud! [votes: 3]
- I'm meeelting!! I'm meeelting!! [votes: 2]
- I'm dirty and plan to stay this way. [votes: 2]
|
Results from Contest # 242 [October 14, 2007 - 337 entries]
 |
 |
I'm here to spay and neuter the cats... [votes: 38] |
Beverly |
 |
McDreamy's got nuthin' on me! [votes: 35] |
Divot |
 |
I have a son, and another son, and another son, and a daughter, and another daughter. [votes: 30] |
Vic |
|
Honorable Mentions
- I'm gonna love performing THIS cat scan!!!! [votes: 29]
- Jack's Anatomy. [votes: 20]
- I delivered 8 litters today... [votes: 19]
- First lick the wound clean, then roll in the dirt. [votes: 19]
- You won't think this is so funny when you see what I did to your shoes... [votes: 19]
- Mr. Vet...the Jack will see you now...hehehe. [votes: 17]
- Lunch Lady Jack. [votes: 15]
- I need a toy, stat! [votes: 12]
- Smooth operator. [votes: 11]
- Jack prepares for his second job a Wal-Mart deli attendant. [votes: 10]
- Just one of the HMO doctors. [votes: 10]
- Wow...what happened last night? [votes: 7]
- Jack had to hide the fact that he was a rough coat, but only around the ears. [votes: 6]
- Beauty school drop out... go back to high school... [votes: 5]
- My turn!!! Where's that thermometer? [votes: 5]
- But you don't understand; I like getting my hair wet! [votes: 3]
- Don't tell the judge that I had my ears done. [votes: 2]
|
Results from Contest # 241 [October 7, 2007 - 263 entries]
 |
 |
And the ball went in here? ... and it's orange? [votes: 96] |
Bobby and DJ |
 |
Jack-o-lanterns. [votes: 68] |
raegan |
 |
Please don't lift Jack's by their stem. [votes: 60] |
Jolee |
|
Honorable Mentions
- I swear, he's in here somewhere! He had a big, toothy grin, and yellow shining eyes. [votes: 41]
- A couple of jacks out of their gourds... [votes: 36]
- Did you see something move? I saw something move!! [votes: 33]
- What's a pumpkin? I don't know, but there's got to be one in here somewhere. [votes: 29]
- The best ones are always at the bottom. [votes: 25]
- Seriously dude, it was smiling at me! [votes: 25]
- I'm tellin' ya Charley, one of 'em has to have a face. [votes: 22]
- ... and that's mine, and that's mine, and that's mine. [votes: 22]
- The Headless Jacks ride again every Halloween! [votes: 22]
- Pumpkin, Pumpkin, Pumpkin, Pumpkin, Pumpkin, Gourd, no wait! Pumpkin! [votes: 19]
- Dig man Dig!!! [votes: 18]
- Jack and Jill realized with horror that they may just be in the wrong nursery rhyme. [votes: 15]
- Dumpster Diving! [votes: 11]
- The end of the pumpkin patch. [votes: 8]
- Just can't wait for pumpkin pie! [votes: 3]
- Sometimes ya gotta take the rough with the smooth during the harvest. [votes: 2]
- Pumpkin head, pumpkin head! [votes: 1]
|
Results from Contest # 240 [September 30, 2007 - 256 entries]
 |
 |
Slumber Jack. [votes: 78] |
Jolee |
 |
Don't wake me unless you have a confirmed squirrel sighting. [votes: 50] |
Anne Wetzork |
 |
Sleeping like a log. [votes: 38] |
Regie Simmons |
|
Honorable Mentions
- Lumber Jack. [votes: 32]
- Ssshhh! Be wery, wery quiet...we're hunting wabbits! [votes: 23]
- Bark-o-lounger [votes: 21]
- Jack rested contently, knowing the squirrels had nowhere else to hide. [votes: 20]
- Wanna know my sleep number? [votes: 18]
- I get more work done by 5am then most dogs get done all day. [votes: 18]
- I'm a lumber Jack and I'm OK... [votes: 17]
- This is not my definition of a "working" terrier! [votes: 15]
- I'm just resting my eyes. [votes: 14]
- Just another bump on a log. [votes: 11]
- Power Nap. [votes: 8]
- Jack was kicked out of drama class for being too wooden. [votes: 6]
- Jack laid there with a splitting headache. [votes: 6]
- My bark is bigger than my bite. [votes: 4]
- All Work And No Play. [votes: 2]
|
Results from Contest # 239 [September 23, 2007 - 205 entries]
 |
 |
Another ugly shirt gift from Grandma. [votes: 29] |
Belle |
 |
Does this shirt go with my tongue? [votes: 28] |
hmpstd |
 |
Clive often wondered why he was labeled a "nerd". [votes: 28] |
Scott Beasley |
|
Honorable Mentions
- Watch out I can't control my licker! [votes: 21]
- Eat your heart out Gene. [votes: 20]
- Jack on Casual Friday. [votes: 18]
- They call me Sponge Bob No Pants! [votes: 18]
- Prep school dropout. [votes: 17]
- Any trace of the cat on here? [votes: 16]
- I make this shirt look good! [votes: 16]
- Look me in the eye, no, the other eye. Oh forget it! Just look at my tongue! [votes: 15]
- Why would you do this to someone you love?! [votes: 14]
- This is what I think of red trim on a light blue shirt. [votes: 11]
- If I could just.. get.. the top button... [votes: 11]
- Stamp licking Jack. [votes: 10]
- Ahhh, I'll never get a date with grandpa dressing me! [votes: 10]
- OK, I'll wear your shirt if you will let me pee on your leg. [votes: 6]
- Poor Jack. He was always picked last for GTG. [votes: 5]
- I only LOOK innocent. [votes: 4]
|
Results from Contest # 238 [September 16, 2007 - 253 entries]
 |
 |
What happens at the boarding kennel, stays at the boarding kennel. [votes: 86] |
Linda |
 |
If lovin' you is wrong, I don't wanna be right. [votes: 47] |
scout |
 |
Little ditty bout Jack and Diane. [votes: 25] |
Tony |
|
Honorable Mentions
- Cat Log Day 3: New cell mate still jumpy. Can't shake feeling she's planning on eating me. [votes: 23]
- Reminder to self: NEVER listen to the cat! [votes: 22]
- Misery loves company. [votes: 15]
- It's bad enough to be arrested, but to put in with a cat... [votes: 15]
- Prison Buddy. [votes: 10]
- Prisoners of Love. [votes: 10]
- He ain't heavy...he's my brother. [votes: 10]
- Well at least Jack got to take his pillow with him to Jail. [votes: 9]
- Behind enemy lines. [votes: 7]
- I've got friends in low places. [votes: 7]
- Opposites attract. [votes: 7]
- Cat nip [votes: 5]
- Jack's first chew toy that made real sense! [votes: 5]
- Desperate times call for desperate measures. [votes: 4]
- Some Things Happen Once In A Lifetime... [votes: 4]
- Only the Lonely [votes: 4]
- Where is that bail Bondsman? [votes: 4]
- Cats got your tongue? [votes: 4]
- Midnight Snack. [votes: 3]
- If you can't do the time, don't do the crime. [votes: 3]
- Here today....gone tomorow! [votes: 3]
- One of these had better be stuffed! [votes: 2]
|
Results from Contest # 237 [September 9, 2007 - 201 entries]
 |
 |
Now thats marking your territory!!! [votes: 70] |
David Hale |
 |
Distance was only one of the reasons the entire pack looked up to spike. [votes: 40] |
Jim P |
 |
Jacks compete for accuracy, Great Danes compete for distance. |
Vicki |
|
Honorable Mentions
- Wow, Sparky had to go REAL bad! [votes: 22]
- Uh, that's not a fountain bro. [votes: 22]
- The tree! The tree! You're suppose to hit the tree! [votes: 22]
- OK, I'm impressed. [votes: 17]
- You go first....No you go first... [votes: 16]
- That better be hose water! [votes: 15]
- Hey dont lick that..I don't think it's a fountain. [votes: 10]
- Cool trick, Bobby, but you ain't gettin' us to chase it! [votes: 6]
- Guys remember never cross the stream or else... [votes: 6]
- I wanna know where that water is coming from. [votes: 6]
- Are WEEEEE having fun yet? [votes: 4]
- Suddenly fire hydrants didn't seem so important now... [votes: 3]
- Where's the lifeguard? [votes: 3]
- Have no fear the pool cleaners are here! [votes: 3]
- He missed again! [votes: 2]
|
Results from Contest # 236 [September 2, 2007 - 357 entries]
 |
 |
Russell Rescue [votes: 67] |
Cheryl |
 |
COWABUNGA DUDE!! [votes: 42] |
Sindy |
 |
I'm.. too sexy for my vest.. too sexy for my board. [votes: 28] |
Thom |
|
Honorable Mentions
- wait for it.......wait for it...... [votes: 26]
- Oh No, that's not the "Jaws" music, is it? [votes: 24]
- Oooooh....Everbody's gone surfin... JRTCA! [votes: 23]
- Bark Watch. [votes: 20]
- 2007 JRTCA National Aquatic agility trials [votes: 18]
- Here I come to save the day!!!! [votes: 18]
- And we will have fun, fun ,fun, till our daddy takes our steak bones away! [votes: 13]
- This thong is killing me! [votes: 12]
- My mom dressed me like this. [votes: 11]
- Watch me "Hang eight". [votes: 11]
- A Three Hour Tour, A Three Hour Tour. [votes: 10]
- I make these look good. [votes: 7]
- I'm so cool, I can't even take it. [votes: 7]
- Jack's endless summer. [votes: 7]
- Waitin' for the big one! [votes: 5]
- Jack be nimble, Jack be Slick, Jack hurry to my boat real quick! [votes: 5]
- Jack couldn't bring himself to be saved by a CAT-amaran! [votes: 4]
- Next time, with truth or dare, I'll choose truth!!! [votes: 4]
- OK, you win.......come back! [votes: 4]
- California dreamin. [votes: 3]
|
Results from Contest # 235 [August 26, 2007 - 216 entries]
 |
 |
When did these chew bones come with a hairball attached? [votes: 48] |
EBT |
 |
I might look small, but it's MINE. [votes: 44] |
kd |
 |
Jack the Gripper [votes: 42] |
Pat |
|
Honorable Mentions
- Your huge paws are no match for my attitude...I suggest you let go!! [votes: 36]
- Chewin' with the BIG dogs! [votes: 34]
- I promise I'll bring it right back. [votes: 22]
- I got my money on the Jack... [votes: 19]
- Size doesn't matter! [votes: 18]
- Brains vs. Brawn. [votes: 18]
- No retreat....no surrender!! [votes: 17]
- Let me help you chew on that. [votes: 16]
- Now If the dog on the Right was bigger, It'd be a Fair fight! [votes: 15]
- bone heads... [votes: 14]
- The mailman didn't have a chance. [votes: 14]
- Beauty and the Beast. [votes: 12]
- I see you're on your last tooth, this will be easy... [votes: 12]
- Courage is... [votes: 10]
- ShareHOLDER [votes: 8]
- No Fear... [votes: 8]
- And I have the results of the paternity tests...right here! [votes: 8]
- I love flirting with danger. [votes: 7]
- Look who Jack brought home! [votes: 5]
- Let's meet in the middle! [votes: 4]
|
Results from Contest # 234 [August 19, 2007 - 339 entries]
 |
 |
I .... want .... OUTTTTTTTTTTTT!!! [votes: 77] |
Julz |
 |
OOOOAKlahoma where the wind ... [votes: 53] |
Nora |
 |
Brother for sale, cheap! [votes: 35] |
jack's girls |
|
Honorable Mentions
- That's IT!! One more Jack in the Box comment and I'm sicking my little brothers on your ankles! [votes: 34]
- HEY Meester, want to buy my seester? [votes: 29]
- I'm obnoxious, pick me! [votes: 29]
- If someone doesn't play with me soon, I'm gonna scream even louder!!! [votes: 21]
- See, still have all my puppy teeth; I am completely harmless to your furniture. [votes: 21]
- LEG CRAMP!!!!!!!!!!!!!! [votes: 21]
- Hey Ump, you stink! [votes: 20]
- Shout! Shout! Let us all out! [votes: 12]
- I want fries with that, please! [votes: 9]
- And stay out!!! [votes: 8]
- I always get stuck with singing the lead in all our road shows. [votes: 6]
- help !! i'm trapped with nonconforming jacks !! [votes: 3]
- Time to make the biscuits! [votes: 2]
- Hey does anyone have any a mint??? [votes: 1]
|
Results from Contest # 233 [August 12, 2007 - 189 entries]
 |
 |
OK, the leak is at the PVC coupling. Hand me a new one, will ya? [votes: 36] |
Sniggy |
 |
Yikes, my roots are showing! [votes: 31] |
Vessey |
 |
I love the smell of gopher in the morning... [votes: 31] |
Brenda |
|
Honorable Mentions
- I don't think I'm in Kansas anymore. [votes: 28]
- This is the BEST place I've ever made! [votes: 23]
- Where am I and where are my pants? [votes: 23]
- MMMMM HOBBIT.......... TASTY! [votes: 22]
- Dirty dog done dirt cheap! [votes: 21]
- This hunting stuff makes you very tired. [votes: 18]
- I'm hiding from my mother-in-law. [votes: 18]
- Power Nap. [votes: 13]
- Am I there yet? [votes: 12]
- Last night I slept like a log....and woke up IN one! [votes: 12]
- I knew I shouldn't have eaten that last donut. [votes: 11]
- I can't believe I ate the whole thing. [votes: 9]
- Was that fun, or what! [votes: 9]
- Here kitty, kitty. [votes: 8]
- Sweet dreams are made of this... [votes: 7]
- HELP! I've fallen and I can't get up. [votes: 4]
- Luxurious Clay Bath. [votes: 3]
- Home dirty home. [votes: 3]
|
Results from Contest # 232 [August 5, 2007 - 278 entries]
 |
 |
Say hello to my little friend... [votes: 45] |
Bailey |
 |
I asked for a brother and this is what I got. [votes: 30] |
Kat |
 |
This is my brother, from another mother. [votes: 27] |
George |
|
Honorable Mentions
- I dare you to take it. [votes: 26]
- Okay, I took the cute picture, can I eat it now? [votes: 25]
- Jack liked to take a picture of his victims... [votes: 19]
- Please play with us. [votes: 17]
- My friend Sammy I want a cookie. Oh, and he said I could have his. [votes: 17]
- Pete and Repeat. [votes: 16]
- Ever notice how toys (like owners) eventually resemble their dogs? [votes: 14]
- Back away slowly and no one will get hurt. [votes: 10]
- Me and my shadow. [votes: 8]
- He ain't heavy... he's my brother. [votes: 7]
- A latchkey dog's best friend. [votes: 6]
- If I hold still enough, the cat will never notice until it's too late! [votes: 6]
- We have only been together for 3 days and the thrill is gone! [votes: 6]
- And Mom said I was the only child! [votes: 5]
- You won't be smiling when I'm done with you! [votes: 5]
- The cat sent my brother to a taxidermist... [votes: 5]
- Good cop, bad cop. [votes: 3]
- Like father like son. [votes: 2]
- Methinks he doth smile too much !!!! [votes: 2]
|
Results from Contest # 231 [July 29, 2007 - 288 entries]
 |
 |
Beware: puppy smarter than owner. [votes: 56] |
Vickie |
 |
Proof that MY Jack Russell is smarter than YOUR honor student. [votes: 45] |
Fritter's Mom |
 |
A baby gate??? That's all you got??? You don't got Jack! [votes: 44] |
Bailey |
|
Honorable Mentions
- Everybody Limbo!!! [votes: 28]
- UNDERdog' [votes: 25]
- No one keeps baby in a cage! [votes: 25]
- It might be a baby gate but it ain't a puppy gate! [votes: 24]
- The Great Escape. [votes: 24]
- Jack be nimble....Jack be quick. [votes: 22]
- One down. Next up lasers and trip wires. [votes: 20]
- I'm busting out of this place, I can't do the time! [votes: 17]
- Does this gate make my butt look big? [votes: 15]
- Problem solved. [votes: 14]
- Here kitty kitty. [votes: 14]
- Don't Fence Me In! [votes: 13]
- I'm gonna pretend I can't get out so my humans won't feel bad--they're so clueless sometimes. [votes: 11]
- I should of dug a little deeper!!!!! [votes: 8]
- Who let the dogs out? [votes: 5]
- He worries about his tail clearing seemed unfounded at this point. [votes: 4]
- Under, ACHIEVER! [votes: 4]
- Jack's got BACK! [votes: 2]
- I think I saw this in a movie once. [votes: 2]
|
Results from Contest # 230 [July 22, 2007 - 213 entries]
 |
 |
Psssstttt, we're diggin' out tonight, pass it on. [votes: 46] |
Alan Lidbom |
 |
They took him to the vet and did WHAT??? [votes: 45] |
Nikki26 |
 |
The REAL Dog Whisperer. [votes: 33] |
Divot |
|
Honorable Mentions
- Stop saying that, I am not adopted! [votes: 31]
- Stop it, honey! I've got to go to work! [votes: 26]
- Pst, I double dog dare ya!!! [votes: 19]
- YIKES! We've been framed! [votes: 16]
- can you keep a secret? [votes: 15]
- I drink out of the toilet. [votes: 15]
- She did what??? [votes: 13]
- ...this one time, at band camp... [votes: 11]
- We gotta think outside the box. [votes: 10]
- I'm not one to gossip, but... [votes: 10]
- Love at first bite. [votes: 8]
- And the password is... [votes: 8]
- A cat walked in to a bar... [votes: 7]
- Look, It's Harry Potter. He passes our portrait everyday and still no bone! [votes: 7]
- The Voices Are Telling Me To Jump! [votes: 6]
- Don't forget to give the judge a "big wet one" right after he checks your teeth! [votes: 6]
- Don't look, but somebody's taking our picture. [votes: 4]
- Jack the QUIPPER. [votes: 3]
|
Results from Contest # 229 [July 15, 2007 - 122 entries]
 |
 |
I'm tellin' ya Jack...these stripes were...not...here an hour ago! [votes: 50] |
Brenda |
 |
You'll be fine. I've ruined plenty of blinds. [votes: 37] |
Clayton |
 |
Shhh, It's the mailman! [votes: 34] |
Diane |
|
Honorable Mentions
- Whatever it is...let's kill it! [votes: 34]
- Hey Pop, did you have to wear a harness when you were little? [votes: 27]
- Love is blind. [votes: 20]
- When you see the cat's shadow-it's lunch time. [votes: 20]
- Stay away from the light. It got Bud back in '99. [votes: 13]
- So, uh, whatcha in for? [votes: 13]
- They're Back !!! [votes: 10]
- I think we're alone now. [votes: 10]
- How do you make a venetian blind? Poke him in the eyes! [votes: 10]
- Reckon we're about to be abducted by aliens, hope there's cats there! [votes: 9]
- The gig is up; remember to blame it on the kid. [votes: 8]
- You've got the brawn, I've got the brains...let's make lots of money. [votes: 7]
- What did ya say?? Man, you made me lose count!! [votes: 6]
- Someday all this will be yours. [votes: 5]
|
Results from Contest # 228 [July 8, 2007 - 244 entries]
 |
 |
Excuse me - did you say I am NOT going on vacation with you? [votes: 62] |
dextersmom |
 |
Don't cha wish your jack was HOT like ME !!!! [votes: 44] |
Roxy |
 |
'Jack' Nicholson. [votes: 37] |
Pat |
|
Honorable Mentions
- Too cool for obedience school. [votes: 34]
- What makes you think Nationals went to my head? [votes: 20]
- My future's so bright, I gotta wear shades. [votes: 17]
- I make this look good... [votes: 17]
- Single Jack Male seeking Single Jack Female, vaccinations not important. [votes: 16]
- Jack of all Shades. [votes: 15]
- Jack-of-all-SHADES. [votes: 14]
- No autographs please! [votes: 11]
- Let's do lunch. I'll have my people get with your people. [votes: 11]
- I wear my sunglasses at night... [votes: 11]
- Seeking female: must be house broken, 51% white, nice gait....strays need not apply. [votes: 11]
- If you ain't got these glasses, you ain't got jack. [votes: 8]
- Jack makes a spectacle of himself for attention. [votes: 8]
- You can't handle the truth about the cat! [votes: 6]
- Jackie Oh! [votes: 4]
- Don't it make my brown eyes BLUE? [votes: 4]
- I ain't nothin' but a hound dog. [votes: 4]
- Don't you get tired of looking at such total PERFECTION? [votes: 3]
- Let's take it outside... [votes: 2]
- Objects (cats) seen may appear closer than they seem. [votes: 1]
|
Results from Contest # 227 [July 1, 2007 - 298 entries]
 |
 |
One of the disadvantages of being a short legged Jack Russell! [votes: 49] |
Helen Mason |
 |
Get in my belly... [votes: 41] |
skip |
 |
I think I can, I think I can, I think I can... [votes: 30] |
Martha |
|
Honorable Mentions
- The Spotted Chef !! [votes: 25]
- No, my instructions clearly specified to put this on the floor... [votes: 24]
- It's Shake-n-Bake and I helped! [votes: 24]
- Is this a fat joke? [votes: 22]
- When will the cat be done? [votes: 20]
- Can I get a little help here? [votes: 18]
- Jack the 'Sniffer'. [votes: 16]
- I'll have mine rare - right now. [votes: 15]
- Here chicky, chicky, chicky... [votes: 9]
- Fatal Attraction. [votes: 8]
- Bacon, bacon, bacon! [votes: 7]
- I like mine with grey hair and a bushy tail! [votes: 7]
- Jack realizes that there's a down side to stove top cooking. [votes: 6]
- 1 For You, 2 For Me. [votes: 5]
|
Results from Contest # 226 [June 24, 2007 - 224 entries]
 |
 |
Jack be nimble, Jack be quick, Jack passed out on a big ol' brick. [votes: 93] |
Hailey Girl |
 |
One tequila, two tequila, three tequila, Floor!! |
Bobbie Jo |
 |
Slumber jack. [votes: 36] |
Michelle |
|
Honorable Mentions
- When you're really tired, any pillow will do. [votes: 30]
- Jack the Napper. [votes: 19]
- Did I get a pillow for Christmas? Noooo, another collar! [votes: 19]
- Jack listened carefully to the brick for hours, yet he still heard nothing. [votes: 19]
- Dog Tired. [votes: 19]
- I feel like Paris Hilton in prison. All I did was bite off the end of the cat's tail!! [votes: 16]
- This is NOT a Holiday Inn Express!!! [votes: 14]
- My head is on the chopping block again. [votes: 13]
- Let sleeping dogs lie. [votes: 13]
- Dog days of summer. [votes: 11]
- Mom always said there would be days like this. [votes: 11]
- Jack on Board! [votes: 9]
- Jack is finally thinking concrete thoughts! [votes: 9]
- Play Hard, Rest Well! [votes: 7]
- I should have waited the 30 minutes after eating before swimming! [votes: 6]
- Union Break. [votes: 5]
- I am tired of being 51% white. [votes: 5]
- A chip off the ol' block... [votes: 4]
- I love the smell of Brick in the Mornin. [votes: 4]
- Yeah, I'm probably too hot but I don't know it yet. [votes: 3]
- This is not as comfortable as it may seem. [votes: 2]
|
Results from Contest # 225 [June 17, 2007 - 279 entries]
 |
 |
Hi, I'm Jack Russell, you must be Jack Daniels. [votes: 59] |
Tam |
 |
Told you not to bite the lamp cord. [votes: 53] |
Herman |
 |
Wow buddy, that must have been one great party! [votes: 41] |
Thom |
|
Honorable Mentions
- Stuck your head out at the car wash didn't you? [votes: 38]
- Yes, it was a skunk... anymore dumb questions???? [votes: 36]
- You short haired Jacks just roll out of bed and look good. It takes a lot of work for me. [votes: 35]
- Just don't ask... [votes: 23]
- If Lindsay Lohan was a Jack Russell. [votes: 22]
- Chased the ole' black cat with the white stripe did ya. Smell you later! [votes: 12]
- One eyed Jack. [votes: 10]
- I'm the favorite. Pass it on. [votes: 9]
- This secret will make your hair stand on end. [votes: 9]
- Notice: this jack russell terrier has just woken up. do not disturb. may pee on carpet. [votes: 8]
- Brylcream... a little dab would do you good. [votes: 8]
- I know I look and smell bad, but you should see the other guy! [votes: 8]
- Guess which Jack used the name brand dog shampoo! [votes: 8]
- Do I HAVE to give Aunty a kiss? [votes: 5]
- MOM!!! Jack's been into your conditioner again! [votes: 4]
- Tell me again. How did you sneek out? [votes: 4]
- Before and After. [votes: 3]
- Go and clean your room. Now! [votes: 1]
- Out chasing squirrels again Jack? [votes: 1]
|
Results from Contest # 224 [June 10, 2007 - 277 entries]
 |
 |
See, I told you the cat was heavier than the muffin. [votes: 98] |
Rick and Rox's Mom |
 |
This is their sick way of getting us to take a bath. [votes: 60] |
branden |
 |
The 5-second rule still applies...doesn't it??? [votes: 43] |
Bailey |
|
Honorable Mentions
- If we stare at it long enough, it will come to us... [votes: 33]
- Her cooking's so bad I was sure it would sink! [votes: 21]
- It's not worth it, Joe ... there' a plate full of 'em on the table! [votes: 21]
- Do You Know The Muffin Man?? [votes: 18]
- Damn Cinnabons. Somebody's gettin' wet. [votes: 18]
- Double The Pleasure, Double the Fun. [votes: 17]
- Did it move? I think it moved, yep, it moved! [votes: 15]
- Is it worth it? [votes: 12]
- I feel sorry for the cat, but he let go of the muffin. [votes: 10]
- The silence of the Jacks... [votes: 10]
- Top o' the muffin to ya! [votes: 8]
- Trick Or Treat? [votes: 5]
- Going, going scone! [votes: 5]
- Everyone outta the pool. [votes: 3]
- You know Mom's just inside the door with a camera, right? [votes: 3]
|
Results from Contest # 223 [June 3, 2007 - 373 entries]
 |
 |
You think you're going without ME--you don't know JACK!! [votes: 77] |
Linda |
 |
You are not leaving me with Grandma, again! [votes: 69] |
Tammy |
 |
What happens at Nationals...Stays at Nationals... [votes: 30] |
SpitFyre |
|
Honorable Mentions
- Hit the Road Jack...! [votes: 24]
- How to get your JRT X-Rayed for free! [votes: 22]
- No Jack Left Behind! [votes: 20]
- Are we there yet??? [votes: 20]
- All my bags are Jacked...I'm ready to go... [votes: 19]
- I'm going to DISNEY WORLD!!! [votes: 16]
- Jack Pack [votes: 15]
- Some day my mom will buy me a travel crate. [votes: 14]
- Jack the Tripper! [votes: 14]
- What the?? Hmm, last thing I remember is closing my eyes, then a zipping sound... [votes: 14]
- Have Jack, will travel. [votes: 11]
- We all come with our own baggage! [votes: 10]
- The best traveling companion anyone can have. [votes: 9]
- Do you think they will serve peanuts on this flight? [votes: 6]
- Will I fit in the overhead bin? [votes: 6]
- Homeward Bound [votes: 6]
- Curses foiled again. [votes: 6]
- Hopefully my people remember to check this as a carry on this time. [votes: 5]
- I hate flying coach... [votes: 4]
- I've always wanted to see France. [votes: 3]
- Time to pack for the next terrier trial. [votes: 3]
- How much extra for carry-on ticket? [votes: 1]
|
Results from Contest # 222 [May 27, 2007 - 304 entries]
 |
 |
How many Jacks does it take to flood the bathroom? [votes: 57] |
Charlotte |
 |
Do we want "C"ookies or "H"amburger? [votes: 53] |
Barb Eales |
 |
If I can reach that razor, we'll shave that cat while he sleeps! [votes: 52] |
sam's dad |
|
Honorable Mentions
- I've seen them... they stand here and the indoor rain comes. [votes: 49]
- JACK-CUZZI. [votes: 49]
- Trust me. I know what I'm doing. [votes: 42]
- It was horrible! NEVER turn this lever to the right. [votes: 39]
- Curiosity Cleaned the Jack. [votes: 32]
- I double dog dare you! [votes: 22]
- Who needs a groomer, we can do this ourself. [votes: 14]
- Hey I wonder what this does? [votes: 11]
- You got the stopper in? How long do you think it will take to fill the room up? [votes: 7]
- If you start singing, I'm outta here. [votes: 6]
- Darn! Still too short to reach the faucet! [votes: 6]
- Gonna wash that Jack right outta my hair! [votes: 5]
- Group shower, I saw this once in a late night movie! [votes: 5]
- No shower for me thanks, I have conformation next week! [votes: 1]
|
Results from Contest # 221 [May 20, 2007 - 267 entries]
 |
 |
Are you sure this is a baby tooth? [votes: 45] |
Daniel |
 |
Jack's reinactment of "Lady and the Tramp" was not going as planned... [votes: 38] |
Erin |
 |
No, I'M taking YOU for a walk. [votes: 38] |
Arthur |
|
Honorable Mentions
- Everybody LIMBO! [votes: 32]
- Jack and Jill devise a plan to tie up the cat. [votes: 31]
- mine mine mine mine [votes: 29]
- You said "no strings attached"! [votes: 24]
- Oh Yeah! That's got it. Thanks man, that piece of cat has been stuck in there for days! [votes: 22]
- Hey, we agreed what mine is mine and what yours is mine. [votes: 19]
- This is BORING, let's go find a squirrel. [votes: 17]
- I'm really at the end of my rope dear. [votes: 13]
- Time out! I'm caught on something... [votes: 10]
- oops..I think I swallowed it! [votes: 7]
- This looked better in the movie. [votes: 7]
- It's going to be a long night. [votes: 6]
- Field day at obedience school. [votes: 6]
- Mom went on a vacation, and all she brought back was this rope...burp...with a cat attached. [votes: 5]
- Sure would be nice to have thumbs eh? [votes: 4]
|
Results from Contest # 220 [May 13, 2007 - 211 entries]
 |
 |
Spot, Spot, Spot and their other brother, SpotLESS. [votes: 64] |
Pat |
 |
We give this food two tails up. [votes: 55] |
hwood |
 |
You idiot! That glue didn't make us "super!" [votes: 54] |
Daniel |
|
Honorable Mentions
- X marks the Spot!! [votes: 28]
- We're losing him doctor! [votes: 25]
- I know we can do it if we put our heads together! [votes: 24]
- Hey guys, last one to finish is a cat lover! [votes: 24]
- JRT Pinwheel Dinner - Eat clockwise. [votes: 17]
- A Meeting of the Minds. [votes: 16]
- Home cookin'! They'll never recall this!!! [votes: 16]
- You realize 6 months from now, we won't be able to do this... [votes: 13]
- You two get the arms. We got the legs. [votes: 9]
- Stop! Stop! My spots are in there! [votes: 9]
- Last one to eat loses his spots! [votes: 5]
- Only surgery could separate them, or the well placed cat. [votes: 4]
- What's for dinner? [votes: 4]
|
Results from Contest # 219 [May 6, 2007 - 348 entries]
 |
 |
You lied in your on-line profile.. didn't you? [votes: 51] |
Jack 1 |
 |
Yes, I ordered my steak rare, but I didn't expect this! [votes: 38] |
Megan R |
 |
To tip, or not to tip, that is the question. [votes: 32] |
swtmdmboo |
|
Honorable Mentions
- This pasture isn't big enough for the two of us. [votes: 32]
- Less than 50% white...you may be excused from the ring. [votes: 31]
- You're the biggest broken coat I've ever seen! [votes: 30]
- ..I said shooo!!, beat it!!........this is my turf steak boy!! [votes: 26]
- My milk shake brings all the jacks to the yard... [votes: 24]
- Whoa, what did I just step in? [votes: 20]
- Get in my belly! [votes: 18]
- Ima gonna chase ya', then ima gonna eat ya'! [votes: 17]
- So much cow... so little time [votes: 15]
- And this one time in obedience camp... [votes: 14]
- Wow mom went all out with dinner!! [votes: 8]
- Didn't we have this same conversation yesterday? [votes: 8]
- Go on .. keep off the grass! [votes: 6]
- He ain't heavy, he's my brother! [votes: 5]
- Jack had to confess that he was lactose intolerant [votes: 5]
- Somebody bring me a pail... [votes: 4]
- That's it! I want a pay raise! [votes: 2]
|
Results from Contest # 218 [April 29, 2007 - 415 entries]
 |
 |
I don't know why they call 'em blinds, I can see right through them. [votes: 66] |
Bailey |
 |
OK the fly is dead. [votes: 49] |
Lori Wells |
 |
How much is that doggie in the window? [votes: 38] |
Pat |
|
Honorable Mentions
- Heeeree's Johnny! [votes: 37]
- I hate to interrupt, but this is important... [votes: 33]
- OOPS, wrong basement. [votes: 26]
- Dang, this looks easy when the cat does it! [votes: 17]
- Love is blinds. [votes: 16]
- No thanks, sorry, I'm just window shopping. [votes: 13]
- Heh, the neighbor's cat doesn't want to play anymore. He just lays there... [votes: 13]
- Lets just say this is the result a long night and 1 too many doggy biscuits. [votes: 12]
- Avon Calling! [votes: 11]
- I knew this was a bad idea. [votes: 11]
- You know for a few pennies more, an elizabethan collar would work. [votes: 10]
- I think Mom is going to be very mad at me. [votes: 10]
- The doggie door was in use. [votes: 10]
- Blinded by his own curosity, Jack just had to peek! [votes: 10]
- Oh ya....I'm watchin you.... [votes: 9]
- I know what you did last summer. [votes: 9]
- Today is so not my day! [votes: 9]
- Heh, why are you sitting on my porcelain water bowl? [votes: 8]
- What a beautiful mess i made. [votes: 7]
- Who put this shade in my doggy door? [votes: 7]
- Wait a minute....am I coming or am I going? [votes: 2]
|
Results from Contest # 217 [April 22, 2007 - 285 entries]
 |
 |
Jumpin Jack Splash. [votes: 74] |
Christa |
 |
Dang! I hate it when they hook it up to the air hose. [votes: 67] |
Shelby GT |
 |
I'm Ready!!!!! Hit the switch... [votes: 34] |
Donna4Jacks |
|
Honorable Mentions
- Hose your daddy? [votes: 26]
- Hit the remote, I'm on pause! [votes: 24]
- You've watered your last lawn... [votes: 23]
- Die alien, die. [votes: 21]
- Ha HA!!! You will NEVER Bathe me!!! [votes: 19]
- You mark my territory, and I'll mark yours! [votes: 18]
- Jack be nimble, Jack be quick. [votes: 15]
- Yeow!!! Cold water! [votes: 15]
- Man, this one's gonna hurt... [votes: 13]
- Uh oh...no water! [votes: 11]
- What does a guy have to do to get a drink around here? [votes: 9]
- Jack was very confused by the invisible water. [votes: 9]
- This landing looks like it might be painful - Houston we have a problem! [votes: 8]
- Leap of faith. [votes: 6]
- Don't leave me hanging in a situation like this! [votes: 5]
- Waiting for the geyser. [votes: 4]
- Matrix. [votes: 4]
- What a fun way to get a bath! [votes: 3]
- Watering, SPOT! [votes: 1]
|
Results from Contest # 216 [April 15, 2007 - 358 entries]
 |
 |
Somebody moved my doggy door...not funny. [votes: 75] |
anonymous |
 |
Who says white dogs can't jump? [votes: 64] |
RileyBean |
 |
Gotta go, gotta go, gotta go right now. [votes: 41] |
Nancy |
|
Honorable Mentions
- Jump up, bark at the mailman. Jump up, bark at the mailman. Jump up, bark at the mailman. [votes: 37]
- Jumpin' Jack! [votes: 25]
- Don't leave meee!!! [votes: 24]
- Mom's home!! [votes: 23]
- I can't see jack out of this little window. [votes: 19]
- The Mail Man is Here! The Mail Man is Here! [votes: 17]
- Mom, come quick, there's a man with a big cardboard check outside. [votes: 17]
- Pizza's here! [votes: 14]
- Has anyone let the dog out this morning? [votes: 11]
- It's Dominos, open the door. [votes: 9]
- Can I see some ID, please? [votes: 9]
- yoo hoo, Mr. Postman... [votes: 8]
- What's the password? [votes: 8]
- She's here! Everybody hide! [votes: 8]
- Wash on delicate, hang to dry. [votes: 8]
- Jack be nimble... [votes: 7]
- Bark, Who goes there??? [votes: 6]
- There's a girl scout at our door!....order more cookies!! [votes: 5]
- Heeeeere's Johnny! [votes: 4]
- Mom told me not to let stangers in while she was gone. [votes: 1]
|
Results from Contest # 215 [April 8, 2007 - 276 entries]
 |
 |
If anybody asks, we did NOT do it, we were taking naps.... [votes: 67] |
Dusty's Mom |
 |
Come on!! You run like a Cat! [votes: 58] |
Mercedes |
 |
If you can't keep up with the little white dogs, stay on the porch! |
Divot |
|
Honorable Mentions
- Run Forrest! Run!!! [votes: 39]
- I think I stepped in something. [votes: 27]
- You put your left leg in.. you put your left leg out... [votes: 26]
- Jacks new jogging partner is a little rusty... [votes: 26]
- Dude! Mom's gonna kill you when she see's how muddy you got! [votes: 21]
- Don't touch me with those muddy paws--I'm wearing WHITE! [votes: 21]
- And then she said I was insensitive! Do you think I'm insensitive? [votes: 21]
- Anything you can do I can do better! [votes: 18]
- You got any last requests before you eat my dust? [votes: 17]
- JRT trials are second on the left, straight ahead for 1 mile. [votes: 14]
- Thelma and Louise. [votes: 10]
- Take a look at my girl friend, she's the only one I got. [votes: 10]
- When we get home, you wanna rip that perfectly good toy that mom bought us yesterday up? [votes: 9]
- Run, run, now feel the burn! [votes: 8]
- Happy Feet. [votes: 6]
- Lets Do Some Hunting! [votes: 4]
- Who let the dogs out? [votes: 4]
|
Results from Contest # 214 [April 1, 2007 - 306 entries]
 |
 |
First I'm gonna de-squeak ya, then I'm gonna eat ya. [votes: 74] |
Bailey |
 |
Who's Your Daddy? SAY IT !!!! SAY IT !!!! [votes: 35] |
Roxy |
 |
Beef...It's what's for dinner... [votes: 35] |
SpitFyre |
|
Honorable Mentions
- Don't you udder another word! [votes: 28]
- All toys must die. [votes: 27]
- My Precious!! [votes: 24]
- Mad Cow, Mad Cow! [votes: 22]
- Now I have you, you cow-ard! [votes: 21]
- Resistance is futile. [votes: 17]
- Jack is lactose intolerant. [votes: 16]
- Snap plastic leg (part A) into body (part B) and your new cow toy is ready for hours of enjoyment! [votes: 14]
- Where's the beef? [votes: 13]
- Any last words? [votes: 12]
- Die before I kill you. [votes: 12]
- Just wait 'till they fire up the grill. [votes: 9]
- Do you know the muffin man? [votes: 7]
- Hey...this one's out of milk!! [votes: 6]
- Any last requests? A blindfold, maybe? [votes: 5]
- The cow was mislead on how the milking was done. [votes: 4]
- Who's the dummy now? [votes: 4]
- What a non creative caption! [votes: 1]
|
Results from Contest # 213 [March 25, 2007 - 248 entries]
 |
 |
That St. Bernard next door must be getting another bath. [votes: 46] |
Dillon |
 |
Jack contemplates how he will attack each and every one... [votes: 41] |
Julz |
 |
So many bubbles so little time. [votes: 40] |
Carol |
|
Honorable Mentions
- I don't think the weatherpeople saw this one coming... [votes: 37]
- If only we could open the door. [votes: 30]
- Look.....at all those balls. [votes: 27]
- Sorry kid... bubbles give me gas. [votes: 24]
- This is way better than snow. [votes: 22]
- I don't think we're in Kansas anymore, Toto!! [votes: 18]
- One day my son, all this shall be yours! [votes: 16]
- Don't worry kid, when you get older I'll teach you how to play with those. [votes: 13]
- After they clean you with the soap bubbles, they put a diaper on you! [votes: 12]
- Yeah, I want to go outside too. You share my pain, brother. [votes: 12]
- Cheap entertainment. [votes: 11]
- They are so pretty... I wonder what they TASTE like! [votes: 10]
- The sky is falling, the sky is falling! [votes: 9]
- How many do you think there are? [votes: 6]
- Connect the dots. [votes: 5]
- It's the most beautiful sight I've ever seen! [votes: 5]
- How many of those do YOU see...? [votes: 4]
|
Results from Contest # 212 [March 18, 2007 - 321 entries]
 |
 |
A little ditty about Jack and Diane. [votes: 47] |
Amy C |
 |
Are we there yet? [votes: 44] |
KaiserJack |
 |
I know she put the groceries back here. [votes: 37] |
Jdurbin |
|
Honorable Mentions
- My Jack is smarter than your honor student! [votes: 35]
- He ain't different, he's my brother. [votes: 29]
- You gonna puke? I'm gonna puke. [votes: 27]
- Say hello to my little friend. [votes: 24]
- Mutt & Jack. [votes: 22]
- What are you guys doing in the trunk? [votes: 19]
- Isn't it fun making faces at the cars behind us? [votes: 19]
- I told you the cat could run really fast... [votes: 15]
- Seat Belts ! We don't need no stinkin' seat belts! [votes: 15]
- Oh-oh...Who's drivin'?! [votes: 12]
- Whatever it is, we didn't do it!! [votes: 12]
- Roadtrip! [votes: 11]
- I think I'm going to be car sick. [votes: 8]
- Stop tailgating me, man!!! [votes: 6]
- Are you thinking what I'm thinking? [votes: 6]
|
Results from Contest # 211 [March 11, 2007 - 321 entries]
 |
 |
Jack and a spare. [votes: 96] |
Susan |
 |
"Lo-Jacks" - A Vehicle Recovery System. [votes: 62] |
Terp's Mom |
 |
Those suitcases won't be necessary - just our bowls, thank you. [votes: 34] |
swtmdmboo |
|
Honorable Mentions
- Tire jacks. [votes: 33]
- Jacks are always good in case of an emergency. [votes: 28]
- Nope, no junk in this trunk! [votes: 21]
- Open carefully, contents under pressure. [votes: 20]
- BABY! I can explain. [votes: 14]
- Honey, does our auto insurance cover bite marks & car jackings? [votes: 14]
- Are we there yet? [votes: 13]
- Spring Break: Jacks gone Wild. [votes: 10]
- ROAD TRIP [votes: 10]
- 125 Horsies up front, two doggies in back. [votes: 10]
- Trunk Drivers. [votes: 10]
- Yeah, we're bootylicious. [votes: 9]
- Luggage? There's no room for luggage in here. [votes: 9]
- We've been very bad... [votes: 7]
- This sure beats sticking our heads out the window! [votes: 7]
- Modern-day fox hunting... [votes: 6]
- I heard the hotel rooms in Europe were small, but geez! [votes: 4]
- Free at last. [votes: 4]
|
Results from Contest # 210 [March 4, 2007 - 357 entries]
 |
 |
Lumber jack! [votes: 48] |
JJ |
 |
Hi, I am a single male Jack who enjoys long walks, good weather and nice trees. [votes: 47] |
Paul M |
 |
Don't worry. I'll be here when that cat comes down. [votes: 41] |
TimT |
|
Honorable Mentions
- 2007 Sexy JRT Calender [votes: 40]
- Jack's senior picture. [votes: 28]
- Sooner or later, it has to come down. [votes: 25]
- Keep on walking buddy, nothing to see here. [votes: 20]
- When I stand like this does it make me look fat? [votes: 20]
- My tree... This is my tree... [votes: 19]
- Can't a guy get a moment of privacy here? [votes: 17]
- I like long walks on the leash and a food bowl for two. [votes: 16]
- You hide and I will seek. [votes: 12]
- Work it girl! Strike a pose! [votes: 12]
- What goes up, must come down. [votes: 12]
- Give me an hour, I'll turn this tree into a beautiful deck. [votes: 11]
- ...barking up the right tree. [votes: 11]
- This tree is all bark and no bite!! [votes: 10]
- So many trees, so little time. [votes: 9]
- This should get me on the cover of True Grit! [votes: 8]
- Now this is my kind of urinal! [votes: 7]
- Sorry, try the next one... this one's occupied. [votes: 5]
- ah no ... someone been here before! [votes: 1]
|
Results from Contest # 209 [February 25, 2007 - 333 entries]
 |
 |
5 jacks and a jill. [votes: 59] |
swtmdmboo |
 |
Dora's Last Exploration. [votes: 53] |
Nick Shadursy |
 |
You pull her to safety, I'll check her pulse. [votes: 50] |
Dianna Gardner |
|
Honorable Mentions
- CSI: Jack Russell Terrier. [votes: 34]
- Dora gets explored! [votes: 29]
- Bad pups, bad pups, whatcha gonna do, whatcha gonna do when they come for you? [votes: 28]
- I don't like her. She seems fake. [votes: 27]
- Let's crate 'er! [votes: 26]
- Dora the Explorer meets Jack the Mauler and his cousins, Vinny, Pete, Frank and Paulo. [votes: 23]
- How do we know for sure she's not one of the "Others"? [votes: 19]
- Cabbage Patch Jacks! [votes: 16]
- Dora is no longer the Explorer. [votes: 16]
- Tastes like pollo! [votes: 15]
- Jack the GRIPPER! [votes: 15]
- Silence of the Dolls. [votes: 14]
- OH Boy - finally somebody our own size to play with. [votes: 13]
- Guys and Doll. [votes: 13]
- She'll never make it in Conformation. [votes: 7]
|
Results from Contest # 208 [February 18, 2007 - 259 entries]
 |
 |
Punxsutawney Jack. [votes: 111] |
Kathy |
 |
Be Very Quiet, we're hunting Wabbit! [votes: 60] |
Matt Haring |
 |
Nope, Not in Florida Yet. Keep digging. [votes: 47] |
Donna4Jacks |
|
Honorable Mentions
- I'm not coming out until you apologize. [votes: 33]
- The ground hog sleeps with the fishes. [votes: 24]
- Had to get away from the wife and kids for awhile. [votes: 20]
- I'm all for Global Warming. [votes: 18]
- Out last, Out wit, Out play. [votes: 15]
- Now is the winter of my discontent... [votes: 15]
- Ah! light at the end of the tunnel! [votes: 14]
- Occupied. [votes: 12]
- Baby it's cold outside!! [votes: 11]
- The weather outside is frightful, but here its so delightful. [votes: 11]
- How to Housebreak Your Dog in Just One Hour. [votes: 10]
- Closer Closer just a little closer. [votes: 8]
- Go to the ground winter edition. [votes: 7]
- Snow Day! [votes: 6]
- Prey goes into hole, Jack goes into hole, our JACK, farewell and adieu to the wee little PREY. [votes: 4]
|
Results from Contest # 207 [February 11, 2007 - 452 entries]
 |
 |
Can you hear me NOW? [votes: 93] |
steff |
 |
Hey there pussy cat, woahhh woaahhhh wooaahh! [votes: 45] |
Rammer |
 |
CCCCCCCAAAAAAAATTTTTTTT !!!!!!!!!! [votes: 39] |
Helen |
|
Honorable Mentions
- Get in my belly!! [votes: 32]
- Ha ha ha ha!!!! Oh, sorry. You're probably tired of the cat jokes. [votes: 28]
- If you look reaaallly close you can see your brother. [votes: 28]
- Sometimes I crack myself up. [votes: 20]
- HOW MANY TIMES do I have to tell you??!!....WIPE...YOUR...PAWS!!! [votes: 19]
- Dogs rule, cats drool!!! [votes: 17]
- Does this tooth look infected to you? [votes: 16]
- You can't handle the truth! [votes: 15]
- I've heard that you can shatter cats by singing the right note. [votes: 15]
- It's a no from me, Sorry, you are not going to Hollywood. [votes: 14]
- I want BACON!!! [votes: 13]
- I think the cat is ignoring me! [votes: 8]
- Cat got your tongue? [votes: 8]
- ...and you play the part of Little Red Ridinghood. [votes: 7]
- So, Simon, Paula.....what do you think? [votes: 6]
- It was just a-ight for me dawg. [votes: 5]
- Make the cat stop. [votes: 3]
- Pray. My Dear Prey. [votes: 3]
|
Results from Contest # 206 [February 4, 2007 - 388 entries]
 |
 |
Jack Frost [votes: 98] |
Pat |
 |
When you said it was knee deep, I thought you meant MY knees! [votes: 48] |
Thom Derry |
 |
Where am I? This rabbit hole started in Florida. [votes: 46] |
Sierra |
|
Honorable Mentions
- Never thought I'd be glad to be neutered... [votes: 38]
- SERIOUSLY!!! It's snowing, I'm done going potty. LET ME IN!!!! [votes: 36]
- I went to ground and came up in Alaska. [votes: 28]
- Jack-sicle [votes: 28]
- If I lick my nose, will it stick? [votes: 23]
- I'm making yellow snow right now. [votes: 22]
- Chili dog! [votes: 19]
- Um...could someone call me a St. Bernard? [votes: 17]
- Ice Ice Baby [votes: 14]
- Global Warming? What Global Warming? [votes: 13]
- And they wonder why we are hard to housebreak. [votes: 12]
- Can you see me now? [votes: 12]
- Baby it's cold outside. [votes: 9]
- 6 more weeks of winter??? REALLY???? [votes: 9]
- I'm thinking Cancun. [votes: 9]
- Thinking Warm Thoughts !! Thinking Warm Thoughts. [votes: 9]
- I hope that chicken noodle soup is ready. [votes: 8]
- Let it snow, let is snow, let it snow. [votes: 7]
- Hey, we like to dig INTO stuff, not OUT of stuff! [votes: 6]
- Definitely 51% white. [votes: 6]
- Al Gore, I'm coming for you!!!! [votes: 5]
- Periscope Up! [votes: 5]
- Frigid dare. [votes: 4]
- Peek...a choo! [votes: 4]
- Look mom no body. [votes: 4]
|
Results from Contest # 205 [January 28, 2007 - 359 entries]
 |
 |
Hush little russell don't say a word, Momma's gonna buy you a flying squirrel! [votes: 52] |
Roxy |
 |
Don't make me turn this stroller around!!! [votes: 43] |
Megan Rees |
 |
Look at me when I am talking to you. [votes: 37] |
Jack |
|
Honorable Mentions
- Don't make me call your father! [votes: 28]
- I think somebody needs a "time out". [votes: 26]
- Are you sure he's mine? [votes: 23]
- I'm old enough to be on a leash mom! [votes: 22]
- This isn't mine is it? I want a paternity test. [votes: 20]
- NO mommy no, I don't wanna go the vet. [votes: 20]
- Yuk! Mom, you have doggy breath! [votes: 20]
- Ok...once more around the block - then we go home. [votes: 18]
- What did you say to me? [votes: 15]
- Don't you eyeball me boy! [votes: 14]
- A visit from Nanny 911. [votes: 13]
- I don't like it either, but Consumer Reports says it's safe. [votes: 11]
- It wasn't funny yesterday and it's still not funny today! [votes: 10]
- Don't be a baby, a spit bath never hurt anyone. [votes: 8]
- Rosemary's Baby. [votes: 7]
- ... and when they come to claim the seat just growl....with conviction. [votes: 7]
- Jack shows his nurturing side. [votes: 6]
- Please... I beg you...do it for your Mother...STOP BARKING!!! [votes: 6]
- You're suppose to push from the back, Jack!! [votes: 6]
- How bad do you want to be in the fraternity? [votes: 4]
|
Results from Contest # 204 [January 21, 2007 - 275 entries]
 |
 |
Lumber Jacks. [votes: 81] |
Bailey |
 |
When we get to shore, remember "I" found it first! [votes: 48] |
Thom Derry |
 |
Cold water, a nice stick, my best buddy....LIFE IS GOOD!!! [votes: 46] |
Jim Long |
|
Honorable Mentions
- Let's swim real fast and trip the duck. [votes: 41]
- This counts as our baths, right??? [votes: 36]
- We always STICK together! [votes: 28]
- How did I ever let you talk me into this...i just wanted to chase the squirrels. [votes: 27]
- United We Swim -- Divided We Sink. [votes: 19]
- You keep saying dog paddle, dog paddle!!! What do you think I am doing? [votes: 18]
- I'm tired of filming this stupid Disney movie. [votes: 17]
- Dog-Paddling. [votes: 16]
- I can't believe I got the short end of the stick! [votes: 15]
- We're gonna need a bigger boat. [votes: 12]
- Are you pulling or pushing? [votes: 12]
- When the Captain says "Don't touch that" he means it !!!! [votes: 11]
- Why is this stick so important? [votes: 10]
- Uh, I don't know about this flotation device, how much further to land? [votes: 6]
- I'm thinking "Pappillon". [votes: 6]
- Job competition. [votes: 4]
- It may not be mud, but we can roll in the dirt afterwards. [votes: 3]
- Wanna split it...? [votes: 2]
- Were just going with the flow. [votes: 1]
|
Results from Contest # 203 [January 14, 2007 - 268 entries]
 |
 |
I still don't understand why they put a DOG BED on my couch. [votes: 111] |
Donna4Jacks |
 |
Another $39.99 well spent! [votes: 72] |
trevor |
 |
Bed for sale - very soft - no view. [votes: 35] |
JO |
|
Honorable Mentions
- If it's so comfortable - You sleep in it! [votes: 31]
- Thinking outside the box. [votes: 29]
- Always go for the window seat. [votes: 26]
- Nope, not after the cat slept in it. [votes: 23]
- How do you expect me to keep an eye on things from down there? [votes: 23]
- Just in case I fall. [votes: 19]
- I like livin' on-the-edge! [votes: 17]
- Snoopy syndrome strikes again. [votes: 14]
- Anywhere Jack lays his head is his home. [votes: 13]
- Cat smell, cat smell, jack no sleep in cat smell. [votes: 9]
- Example of separation anxiety. [votes: 8]
- Bunk beds. [votes: 7]
- Another failed idea! [votes: 5]
- Don't be fooled by imitations. [votes: 5]
- Sleeping in the loft. [votes: 4]
- I missed. [votes: 3]
- I do all my own stunts! [votes: 3]
|
Results from Contest # 202 [January 7, 2007 - 393 entries]
 |
 |
Russell, Jack Russell. [votes: 126] |
Sindy |
 |
Every girl's crazy about a sharp dressed jack. [votes: 41] |
rebecca91 |
 |
I'm bringing SEXY back! [votes: 33] |
Riley B |
|
Honorable Mentions
- We meet again, Mr. Bond. [votes: 30]
- Frankly my dear, I don't give a damn. [votes: 26]
- I'll take my kibble shaken... not stirred. [votes: 24]
- I'm too sexy for my shirt. [votes: 23]
- All dressed up with nothing to chew. [votes: 20]
- My name is JACK and i will be your waiter tonight. [votes: 20]
- The difference between me and you is, I make this look GOOD. [votes: 19]
- Simply irresistible! [votes: 10]
- I doo, I doo, can I lick the bride? [votes: 8]
- Did you say sauteed feline? That sounds good, I'll have that! [votes: 8]
- Jackolicious [votes: 6]
- I do, I don't, I do, I don't...I can't do this! Wait!! Isn't there going to be cake? I DO!!!! [votes: 6]
- That was one heck of a party! I think I kissed the cat... [votes: 6]
- These confirmation awards ceremonies are getting a little to formal... know what I mean? [votes: 6]
- Where the ladies at? [votes: 5]
- Got my tie and tails... [votes: 5]
- One of my better prom dates! [votes: 4]
- For better or worse, for richer or poorer... [votes: 3]
- A mischief in disguise. [votes: 3]
- My bowl is a black tie affair. [votes: 2]
- By Invitation Only [votes: 1]
|