Jack Russell Terrier Picture Caption Contest Results

Results from Contest # 252 [December 30, 2007 - 178 entries]

		PUPsicle. [votes: 50]	Pat
		You have a little something on your chin. [votes: 44]	Chris
		5...4...3...2...1... Happy New Year!! (smooch) [votes: 33]	Greggo
	Honorable Mentions Takes a lickin', keeps on tickin'. [votes: 26] I hate spit baths. [votes: 21] No tongues! NOOOOO tongues!! [votes: 14] Don't worry...I'm a trained professional. [votes: 12] One down, ten to go. [votes: 11] Who doesn't love the new year baby?! [votes: 11] Do you think this will get us on the internet? [votes: 11] Spot-checking. [votes: 10] I love you man! [votes: 9] Jack be nimble, jack be lick! [votes: 9] Curbside tongue service. [votes: 6] I don't know. Ask your mom. [votes: 3] I surrender!!!! [votes: 2]

Results from Contest # 251 [December 23, 2007 - 108 entries]

		You vill NOT take zees tennis ball! Nein! Nein! [votes: 45]	Kirie W
		My human has too much time on his hands. [votes: 32]	Pat
		It's like eating a squirrel. Once you get the fur off, it's nice and chewy. [votes: 29]	cred
	Honorable Mentions The hat gets returned, but I keep the ball! [votes: 21] Jack In The Hat. [votes: 20] My hat's too big and my mouth's too small! [votes: 20] Yes, I Drink Alone! [votes: 13] Couches, tennis balls and Harley Davidson hats, these are a few of my favorite things. [votes: 13] Are you sure this is gonna impress the judges???? [votes: 11] Why do people think this is so funny? [votes: 9] Open mouth, insert ball. [votes: 9] Has the ball dropped yet? [votes: 9] Newest member of the "Jacks of Columbus". [votes: 7] Back away, there is nothing to see here. [votes: 6] I wear this so they can spot me in the snow. [votes: 4]

Results from Contest # 250 [December 16, 2007 - 190 entries]

		This means she gave the baby my chew toy again. I hate when she loses her glasses! [votes: 66]	cred
		If you think this is gonna shut me up you are so wrong. [votes: 43]	Bevansley
		Yeah I took it from the kid and not giving it back. [votes: 27]	anon
	Honorable Mentions These thing'll never replace a good crunchy squirrel. [votes: 15] Silence of the Jacks. [votes: 13] And poor Jack needed therapy the rest of his life. [votes: 12] Dude, the cat is laughing at me. [votes: 12] Yelp control. [votes: 11] Got binky? [votes: 8] What she doesn't know, is that I just destroyed her shoe. [votes: 7] This is no way to break my chipmunk habit. [votes: 7] This dingo ate your baby! [votes: 7] Please don't take my binnky. [votes: 5] I better knock it off. I'm gonna have an overbite!!! [votes: 5] Jack love his binky. [votes: 3] Preparing for the baby. [votes: 2] Please save me! Please! [votes: 2] Nobody puts baby in the corner! [votes: 2] 21 Seconds to a Pacified Dog. [votes: 2]

Results from Contest # 249 [December 9, 2007 - 266 entries]

		Santa's little YELPER. [votes: 48]	Pat
		Reason 101 why animals attack during the holidays. [votes: 34]	Mandy
		Clearly, Jack has been spending too much time at elfyourself.com. [votes: 25]	vicki
	Honorable Mentions This is as jolly as I'm gonna get! [votes: 23] HOHOHO! I left a nice gift under the tree. [votes: 21] I ate the naughty list, because my name was on it. [votes: 19] Yeah, I ate an elf...so what? [votes: 18] This is elfin embarrassing. [votes: 17] I'm only doing this for the presents! [votes: 16] Hand over the cookies or the Fat man gets it. [votes: 12] All I want for christmas is for it to be OVER... [votes: 12] I'm one of Oprah's favorite things! [votes: 7] OH YEAH,... I'M KEEPING A LIST... [votes: 7] I make this look cool. [votes: 6] Elves taste good with ketchup. [votes: 6] I've been a baad elf! [votes: 6] Jack makes an elf of himself. [votes: 6] Hermey wants to be a dentist... [votes: 6] I have the sense people are staring at me this moment... [votes: 4] Pssst....I've got the keys to the sleigh tonight. [votes: 3] All I want for Chistmas is a cat in my teeth! [votes: 3] Ho, Ho, Hole!!!! [votes: 2] Don't mess with the elf! [votes: 1] How about a little elf magic? [votes: 1]

Results from Contest # 248 [December 2, 2007 - 223 entries]

		I didn't do it! It was like that when I got here! [votes: 68]	C
		This chicken will not be crossing the road. [votes: 32]	Debbie W
		I killed it...You cook it. [votes: 28]	Bevansley
	Honorable Mentions What am I supposed to do with this? [votes: 23] Mom, look what the cat dragged in! [votes: 15] We'll make the breast of it... [votes: 15] Okay, who's next? [votes: 15] Jack Be Nimble Jack Be Quick, Jack Didn't Know What To Do With The Chick. [votes: 14] May I ask what the chicken did? [votes: 14] Another one bites the dust. [votes: 11] That's mine, don't touch it. [votes: 9] Me thinks me killed the chicken, better not look. [votes: 9] Help, the chick has fallen and can't get up!! [votes: 8] Another boring banquet rubber chicken dinner! [votes: 8] Excuse me...I think the chicken has gone bad... [votes: 7] Waiter! Where's my bowl of Chardonnay? [votes: 5] Allow me to say a few words about the chicken. [votes: 5] The new BARF diet. [votes: 4] Chicken tonight! [votes: 1] Chicken......just the way I like it !! [votes: 1] My first go-to-ground win. [votes: 1]

Results from Contest # 247 [November 25, 2007 - 262 entries]

		MOM!!!.... HE'S TOUCHING MEEEE!!!! [votes: 77]	Sindy
		I hope this isn't your favorite cat. [votes: 30]	Doug
		oh darn, witnesses... [votes: 25]	jimmy
	Honorable Mentions That's it - blind me with the flash - just when I corner the cat? [votes: 20] OK, this is the last time I answer a personal ad! [votes: 20] Go to a happy place! Go to a happy place! Go to a happy place!! [votes: 18] Oh man....this wasn't supposed to be on camera! [votes: 16] I should have known, she's going right for the jewelry. [votes: 15] I like 'em to think they have a chance before I eat 'em. [votes: 15] Somebody please adopt me...NOW! [votes: 14] What did I do? [votes: 12] Jack knew right then that this relationship would never work out. [votes: 11] It's going to be one of those days. [votes: 10] What do you mean your mother is coming for the weekend? [votes: 8] Playing with my food. [votes: 7] When did my life take such a terrible turn? [votes: 6] Tabby was never seen again. [votes: 6] Did I thank you for my new Squeaky toy? [votes: 6] When good cats go bad. [votes: 5] Got Cat???? I do!!! [votes: 4]

Results from Contest # 246 [November 18, 2007 - 214 entries]

		It's going to take a while to get the squeaker out of this one! [votes: 45]	Vickie
		Jack thought he better be nice to the new cat. [votes: 37]	vickie
		Keep smiling, they're almost gone. [votes: 31]	Sarah M
	Honorable Mentions Wait for it...wait for it... [votes: 21] Jack Spratt could eat no fat; his wife could eat no lean. [votes: 21] Yeah I know Dad, she's not from around here. [votes: 18] I jump around constantly, what is your superpower? [votes: 17] I've got you babe. [votes: 16] One good reason to spay and neuter! [votes: 15] I hate when the frisbee goes over the fence. [votes: 14] When Harry met Not-So-Harry. [votes: 13] The boss is a need'n the 15 bones you owe him. [votes: 12] Your haircut looks really nice, hon. [votes: 10] Jack now regrets being the wingman. [votes: 7] I've heard of bed head, but this must be kennel head! [votes: 7] Give me your coat. [votes: 5] Look what I dug up. [votes: 5] Eskimo Jack visiting the lower 48. [votes: 4] Would you look at that.. [votes: 4]

Results from Contest # 245 [November 11, 2007 - 267 entries]

		You're not as big as I think I am. [votes: 48]	parker
		Fox Hunt on Saturday? Count me in! [votes: 38]	Divot
		You gotta win tomorrow, I bet all my biscuits. [votes: 34]	luanne
	Honorable Mentions "... and then I struck this pose, and won the show." [votes: 24] I'll get the gate, you take the blame, got it? Good. [votes: 21] Listen horse, big is all in the attitude! [votes: 21] If you are 50% white and can stand like this, I can get you in. [votes: 16] I'm Wilber, what your name? [votes: 15] The Horse Whisperer. [votes: 15] I thought I was the long legged, 50% white, smooth coat. [votes: 14] ... and there was this one time at band camp. [votes: 14] "Are you my mother?" "Neigh." [votes: 10] That's a mighty fine crate you have! [votes: 9] Lookin' for love in all the wrong places. [votes: 9] You must be an over! [votes: 7] I'm going to give you one more chance to tell the truth. Then it's going to get ugly. [votes: 7] One neighsayer didn't know Jack! [votes: 7] Howdy partner! [votes: 6] You had me at hello! [votes: 4] Yeah, I'm betting on you in the Derby. [votes: 3] How's the weather up there? [votes: 3] Are you thinking what I'm thinking? [votes: 1]

Results from Contest # 244 [November 4, 2007 - 203 entries]

		Jacky plans his getaway from obedience class.	Becky
		Tour De Jack. [votes: 37]	Gerry Hazelton
		This agility training is just getting out of hand! [votes: 35]	Matt Haring
	Honorable Mentions I never thought I'd be thanking God for being NEUTERED! [votes: 28] Must... catch... mailman! [votes: 25] Who put this junk on my beautiful dirt?? [votes: 20] This doesn't feel right. And I look stupid. [votes: 19] Too bad I chewed all the rubber of the tires, this would have been fun to ride. [votes: 15] THE COLLIES Are COMING... THE COLLIES ARE COMING ... [votes: 15] Whadaya mean it's a lawn ornament? [votes: 14] Easy Rider. [votes: 14] Let them heel -- I'm gonna WHEEL! [votes: 13] Two tires, and a splash of gas - Daytona "2008" here I come!!! [votes: 11] ooouch!! Aren't these things suppose to have seats?? [votes: 10] What do you mean they're still not looking? [votes: 10] Jack realized in horror that his bike may have been a rip off! [votes: 10] Gotta get away from all these shelties. [votes: 9] WHAT! no horn on it? [votes: 6] If I wanted to go in circles, I would have just chased my tail. [votes: 6] I run faster than I pedal... [votes: 5] Hey, this isn't my bike, mine moves. [votes: 5] Wow! I'm jealous it's 100% white. [votes: 4] Jack be nimble. [votes: 3] oops - I think I've split my difference! [votes: 3] Wheel meet again. [votes: 2] Jack's stationary bike. [votes: 1]

Results from Contest # 243 [October 28, 2007 - 267 entries]

		If you think I am dirty, you should see the cat I'm standing on. [votes: 77]	Bill He
		The next thing you know 'ol Jack's a millionaire... [votes: 56]	Clampett
		I think I found your problem, lady. [votes: 50]	Steve T
	Honorable Mentions I guess sleeping in the bed is out of the question. [votes: 31] What do you mean I need a bath? [votes: 29] Life is good. [votes: 21] Come on in; the water's fine! [votes: 16] Muddy Buddy. [votes: 16] Heaven!! [votes: 15] It puts the lotion on the skin! Or it gets the hose again! [votes: 15] Got Mud! [votes: 15] Jack fell down a well....but saw no reason to get out! [votes: 9] I think I went too far to ground. [votes: 8] I'm still 51% white. [votes: 7] Sometimes it's just too challenging to clean up after your dog. [votes: 6] I'm 17% white! [votes: 5] Going to Ground should be cancelled during the rainy season! [votes: 4] I hope this is mud! [votes: 3] I'm meeelting!! I'm meeelting!! [votes: 2] I'm dirty and plan to stay this way. [votes: 2]

Results from Contest # 242 [October 14, 2007 - 337 entries]

		I'm here to spay and neuter the cats... [votes: 38]	Beverly
		McDreamy's got nuthin' on me! [votes: 35]	Divot
		I have a son, and another son, and another son, and a daughter, and another daughter. [votes: 30]	Vic
	Honorable Mentions I'm gonna love performing THIS cat scan!!!! [votes: 29] Jack's Anatomy. [votes: 20] I delivered 8 litters today... [votes: 19] First lick the wound clean, then roll in the dirt. [votes: 19] You won't think this is so funny when you see what I did to your shoes... [votes: 19] Mr. Vet...the Jack will see you now...hehehe. [votes: 17] Lunch Lady Jack. [votes: 15] I need a toy, stat! [votes: 12] Smooth operator. [votes: 11] Jack prepares for his second job a Wal-Mart deli attendant. [votes: 10] Just one of the HMO doctors. [votes: 10] Wow...what happened last night? [votes: 7] Jack had to hide the fact that he was a rough coat, but only around the ears. [votes: 6] Beauty school drop out... go back to high school... [votes: 5] My turn!!! Where's that thermometer? [votes: 5] But you don't understand; I like getting my hair wet! [votes: 3] Don't tell the judge that I had my ears done. [votes: 2]

Results from Contest # 241 [October 7, 2007 - 263 entries]

		And the ball went in here? ... and it's orange? [votes: 96]	Bobby and DJ
		Jack-o-lanterns. [votes: 68]	raegan
		Please don't lift Jack's by their stem. [votes: 60]	Jolee
	Honorable Mentions I swear, he's in here somewhere! He had a big, toothy grin, and yellow shining eyes. [votes: 41] A couple of jacks out of their gourds... [votes: 36] Did you see something move? I saw something move!! [votes: 33] What's a pumpkin? I don't know, but there's got to be one in here somewhere. [votes: 29] The best ones are always at the bottom. [votes: 25] Seriously dude, it was smiling at me! [votes: 25] I'm tellin' ya Charley, one of 'em has to have a face. [votes: 22] ... and that's mine, and that's mine, and that's mine. [votes: 22] The Headless Jacks ride again every Halloween! [votes: 22] Pumpkin, Pumpkin, Pumpkin, Pumpkin, Pumpkin, Gourd, no wait! Pumpkin! [votes: 19] Dig man Dig!!! [votes: 18] Jack and Jill realized with horror that they may just be in the wrong nursery rhyme. [votes: 15] Dumpster Diving! [votes: 11] The end of the pumpkin patch. [votes: 8] Just can't wait for pumpkin pie! [votes: 3] Sometimes ya gotta take the rough with the smooth during the harvest. [votes: 2] Pumpkin head, pumpkin head! [votes: 1]

Results from Contest # 240 [September 30, 2007 - 256 entries]

		Slumber Jack. [votes: 78]	Jolee
		Don't wake me unless you have a confirmed squirrel sighting. [votes: 50]	Anne Wetzork
		Sleeping like a log. [votes: 38]	Regie Simmons
	Honorable Mentions Lumber Jack. [votes: 32] Ssshhh! Be wery, wery quiet...we're hunting wabbits! [votes: 23] Bark-o-lounger [votes: 21] Jack rested contently, knowing the squirrels had nowhere else to hide. [votes: 20] Wanna know my sleep number? [votes: 18] I get more work done by 5am then most dogs get done all day. [votes: 18] I'm a lumber Jack and I'm OK... [votes: 17] This is not my definition of a "working" terrier! [votes: 15] I'm just resting my eyes. [votes: 14] Just another bump on a log. [votes: 11] Power Nap. [votes: 8] Jack was kicked out of drama class for being too wooden. [votes: 6] Jack laid there with a splitting headache. [votes: 6] My bark is bigger than my bite. [votes: 4] All Work And No Play. [votes: 2]

Results from Contest # 239 [September 23, 2007 - 205 entries]

		Another ugly shirt gift from Grandma. [votes: 29]	Belle
		Does this shirt go with my tongue? [votes: 28]	hmpstd
		Clive often wondered why he was labeled a "nerd". [votes: 28]	Scott Beasley
	Honorable Mentions Watch out I can't control my licker! [votes: 21] Eat your heart out Gene. [votes: 20] Jack on Casual Friday. [votes: 18] They call me Sponge Bob No Pants! [votes: 18] Prep school dropout. [votes: 17] Any trace of the cat on here? [votes: 16] I make this shirt look good! [votes: 16] Look me in the eye, no, the other eye. Oh forget it! Just look at my tongue! [votes: 15] Why would you do this to someone you love?! [votes: 14] This is what I think of red trim on a light blue shirt. [votes: 11] If I could just.. get.. the top button... [votes: 11] Stamp licking Jack. [votes: 10] Ahhh, I'll never get a date with grandpa dressing me! [votes: 10] OK, I'll wear your shirt if you will let me pee on your leg. [votes: 6] Poor Jack. He was always picked last for GTG. [votes: 5] I only LOOK innocent. [votes: 4]

Results from Contest # 238 [September 16, 2007 - 253 entries]

		What happens at the boarding kennel, stays at the boarding kennel. [votes: 86]	Linda
		If lovin' you is wrong, I don't wanna be right. [votes: 47]	scout
		Little ditty bout Jack and Diane. [votes: 25]	Tony
	Honorable Mentions Cat Log Day 3: New cell mate still jumpy. Can't shake feeling she's planning on eating me. [votes: 23] Reminder to self: NEVER listen to the cat! [votes: 22] Misery loves company. [votes: 15] It's bad enough to be arrested, but to put in with a cat... [votes: 15] Prison Buddy. [votes: 10] Prisoners of Love. [votes: 10] He ain't heavy...he's my brother. [votes: 10] Well at least Jack got to take his pillow with him to Jail. [votes: 9] Behind enemy lines. [votes: 7] I've got friends in low places. [votes: 7] Opposites attract. [votes: 7] Cat nip [votes: 5] Jack's first chew toy that made real sense! [votes: 5] Desperate times call for desperate measures. [votes: 4] Some Things Happen Once In A Lifetime... [votes: 4] Only the Lonely [votes: 4] Where is that bail Bondsman? [votes: 4] Cats got your tongue? [votes: 4] Midnight Snack. [votes: 3] If you can't do the time, don't do the crime. [votes: 3] Here today....gone tomorow! [votes: 3] One of these had better be stuffed! [votes: 2]

Results from Contest # 237 [September 9, 2007 - 201 entries]

		Now thats marking your territory!!! [votes: 70]	David Hale
		Distance was only one of the reasons the entire pack looked up to spike. [votes: 40]	Jim P
		Jacks compete for accuracy, Great Danes compete for distance.	Vicki
	Honorable Mentions Wow, Sparky had to go REAL bad! [votes: 22] Uh, that's not a fountain bro. [votes: 22] The tree! The tree! You're suppose to hit the tree! [votes: 22] OK, I'm impressed. [votes: 17] You go first....No you go first... [votes: 16] That better be hose water! [votes: 15] Hey dont lick that..I don't think it's a fountain. [votes: 10] Cool trick, Bobby, but you ain't gettin' us to chase it! [votes: 6] Guys remember never cross the stream or else... [votes: 6] I wanna know where that water is coming from. [votes: 6] Are WEEEEE having fun yet? [votes: 4] Suddenly fire hydrants didn't seem so important now... [votes: 3] Where's the lifeguard? [votes: 3] Have no fear the pool cleaners are here! [votes: 3] He missed again! [votes: 2]

Results from Contest # 236 [September 2, 2007 - 357 entries]

		Russell Rescue [votes: 67]	Cheryl
		COWABUNGA DUDE!! [votes: 42]	Sindy
		I'm.. too sexy for my vest.. too sexy for my board. [votes: 28]	Thom
	Honorable Mentions wait for it.......wait for it...... [votes: 26] Oh No, that's not the "Jaws" music, is it? [votes: 24] Oooooh....Everbody's gone surfin... JRTCA! [votes: 23] Bark Watch. [votes: 20] 2007 JRTCA National Aquatic agility trials [votes: 18] Here I come to save the day!!!! [votes: 18] And we will have fun, fun ,fun, till our daddy takes our steak bones away! [votes: 13] This thong is killing me! [votes: 12] My mom dressed me like this. [votes: 11] Watch me "Hang eight". [votes: 11] A Three Hour Tour, A Three Hour Tour. [votes: 10] I make these look good. [votes: 7] I'm so cool, I can't even take it. [votes: 7] Jack's endless summer. [votes: 7] Waitin' for the big one! [votes: 5] Jack be nimble, Jack be Slick, Jack hurry to my boat real quick! [votes: 5] Jack couldn't bring himself to be saved by a CAT-amaran! [votes: 4] Next time, with truth or dare, I'll choose truth!!! [votes: 4] OK, you win.......come back! [votes: 4] California dreamin. [votes: 3]

Results from Contest # 235 [August 26, 2007 - 216 entries]

		When did these chew bones come with a hairball attached? [votes: 48]	EBT
		I might look small, but it's MINE. [votes: 44]	kd
		Jack the Gripper [votes: 42]	Pat
	Honorable Mentions Your huge paws are no match for my attitude...I suggest you let go!! [votes: 36] Chewin' with the BIG dogs! [votes: 34] I promise I'll bring it right back. [votes: 22] I got my money on the Jack... [votes: 19] Size doesn't matter! [votes: 18] Brains vs. Brawn. [votes: 18] No retreat....no surrender!! [votes: 17] Let me help you chew on that. [votes: 16] Now If the dog on the Right was bigger, It'd be a Fair fight! [votes: 15] bone heads... [votes: 14] The mailman didn't have a chance. [votes: 14] Beauty and the Beast. [votes: 12] I see you're on your last tooth, this will be easy... [votes: 12] Courage is... [votes: 10] ShareHOLDER [votes: 8] No Fear... [votes: 8] And I have the results of the paternity tests...right here! [votes: 8] I love flirting with danger. [votes: 7] Look who Jack brought home! [votes: 5] Let's meet in the middle! [votes: 4]

Results from Contest # 234 [August 19, 2007 - 339 entries]

		I .... want .... OUTTTTTTTTTTTT!!! [votes: 77]	Julz
		OOOOAKlahoma where the wind ... [votes: 53]	Nora
		Brother for sale, cheap! [votes: 35]	jack's girls
	Honorable Mentions That's IT!! One more Jack in the Box comment and I'm sicking my little brothers on your ankles! [votes: 34] HEY Meester, want to buy my seester? [votes: 29] I'm obnoxious, pick me! [votes: 29] If someone doesn't play with me soon, I'm gonna scream even louder!!! [votes: 21] See, still have all my puppy teeth; I am completely harmless to your furniture. [votes: 21] LEG CRAMP!!!!!!!!!!!!!! [votes: 21] Hey Ump, you stink! [votes: 20] Shout! Shout! Let us all out! [votes: 12] I want fries with that, please! [votes: 9] And stay out!!! [votes: 8] I always get stuck with singing the lead in all our road shows. [votes: 6] help !! i'm trapped with nonconforming jacks !! [votes: 3] Time to make the biscuits! [votes: 2] Hey does anyone have any a mint??? [votes: 1]

Results from Contest # 233 [August 12, 2007 - 189 entries]

		OK, the leak is at the PVC coupling. Hand me a new one, will ya? [votes: 36]	Sniggy
		Yikes, my roots are showing! [votes: 31]	Vessey
		I love the smell of gopher in the morning... [votes: 31]	Brenda
	Honorable Mentions I don't think I'm in Kansas anymore. [votes: 28] This is the BEST place I've ever made! [votes: 23] Where am I and where are my pants? [votes: 23] MMMMM HOBBIT.......... TASTY! [votes: 22] Dirty dog done dirt cheap! [votes: 21] This hunting stuff makes you very tired. [votes: 18] I'm hiding from my mother-in-law. [votes: 18] Power Nap. [votes: 13] Am I there yet? [votes: 12] Last night I slept like a log....and woke up IN one! [votes: 12] I knew I shouldn't have eaten that last donut. [votes: 11] I can't believe I ate the whole thing. [votes: 9] Was that fun, or what! [votes: 9] Here kitty, kitty. [votes: 8] Sweet dreams are made of this... [votes: 7] HELP! I've fallen and I can't get up. [votes: 4] Luxurious Clay Bath. [votes: 3] Home dirty home. [votes: 3]

Results from Contest # 232 [August 5, 2007 - 278 entries]

		Say hello to my little friend... [votes: 45]	Bailey
		I asked for a brother and this is what I got. [votes: 30]	Kat
		This is my brother, from another mother. [votes: 27]	George
	Honorable Mentions I dare you to take it. [votes: 26] Okay, I took the cute picture, can I eat it now? [votes: 25] Jack liked to take a picture of his victims... [votes: 19] Please play with us. [votes: 17] My friend Sammy I want a cookie. Oh, and he said I could have his. [votes: 17] Pete and Repeat. [votes: 16] Ever notice how toys (like owners) eventually resemble their dogs? [votes: 14] Back away slowly and no one will get hurt. [votes: 10] Me and my shadow. [votes: 8] He ain't heavy... he's my brother. [votes: 7] A latchkey dog's best friend. [votes: 6] If I hold still enough, the cat will never notice until it's too late! [votes: 6] We have only been together for 3 days and the thrill is gone! [votes: 6] And Mom said I was the only child! [votes: 5] You won't be smiling when I'm done with you! [votes: 5] The cat sent my brother to a taxidermist... [votes: 5] Good cop, bad cop. [votes: 3] Like father like son. [votes: 2] Methinks he doth smile too much !!!! [votes: 2]

Results from Contest # 231 [July 29, 2007 - 288 entries]

		Beware: puppy smarter than owner. [votes: 56]	Vickie
		Proof that MY Jack Russell is smarter than YOUR honor student. [votes: 45]	Fritter's Mom
		A baby gate??? That's all you got??? You don't got Jack! [votes: 44]	Bailey
	Honorable Mentions Everybody Limbo!!! [votes: 28] UNDERdog' [votes: 25] No one keeps baby in a cage! [votes: 25] It might be a baby gate but it ain't a puppy gate! [votes: 24] The Great Escape. [votes: 24] Jack be nimble....Jack be quick. [votes: 22] One down. Next up lasers and trip wires. [votes: 20] I'm busting out of this place, I can't do the time! [votes: 17] Does this gate make my butt look big? [votes: 15] Problem solved. [votes: 14] Here kitty kitty. [votes: 14] Don't Fence Me In! [votes: 13] I'm gonna pretend I can't get out so my humans won't feel bad--they're so clueless sometimes. [votes: 11] I should of dug a little deeper!!!!! [votes: 8] Who let the dogs out? [votes: 5] He worries about his tail clearing seemed unfounded at this point. [votes: 4] Under, ACHIEVER! [votes: 4] Jack's got BACK! [votes: 2] I think I saw this in a movie once. [votes: 2]

Results from Contest # 230 [July 22, 2007 - 213 entries]

		Psssstttt, we're diggin' out tonight, pass it on. [votes: 46]	Alan Lidbom
		They took him to the vet and did WHAT??? [votes: 45]	Nikki26
		The REAL Dog Whisperer. [votes: 33]	Divot
	Honorable Mentions Stop saying that, I am not adopted! [votes: 31] Stop it, honey! I've got to go to work! [votes: 26] Pst, I double dog dare ya!!! [votes: 19] YIKES! We've been framed! [votes: 16] can you keep a secret? [votes: 15] I drink out of the toilet. [votes: 15] She did what??? [votes: 13] ...this one time, at band camp... [votes: 11] We gotta think outside the box. [votes: 10] I'm not one to gossip, but... [votes: 10] Love at first bite. [votes: 8] And the password is... [votes: 8] A cat walked in to a bar... [votes: 7] Look, It's Harry Potter. He passes our portrait everyday and still no bone! [votes: 7] The Voices Are Telling Me To Jump! [votes: 6] Don't forget to give the judge a "big wet one" right after he checks your teeth! [votes: 6] Don't look, but somebody's taking our picture. [votes: 4] Jack the QUIPPER. [votes: 3]

Results from Contest # 229 [July 15, 2007 - 122 entries]

		I'm tellin' ya Jack...these stripes were...not...here an hour ago! [votes: 50]	Brenda
		You'll be fine. I've ruined plenty of blinds. [votes: 37]	Clayton
		Shhh, It's the mailman! [votes: 34]	Diane
	Honorable Mentions Whatever it is...let's kill it! [votes: 34] Hey Pop, did you have to wear a harness when you were little? [votes: 27] Love is blind. [votes: 20] When you see the cat's shadow-it's lunch time. [votes: 20] Stay away from the light. It got Bud back in '99. [votes: 13] So, uh, whatcha in for? [votes: 13] They're Back !!! [votes: 10] I think we're alone now. [votes: 10] How do you make a venetian blind? Poke him in the eyes! [votes: 10] Reckon we're about to be abducted by aliens, hope there's cats there! [votes: 9] The gig is up; remember to blame it on the kid. [votes: 8] You've got the brawn, I've got the brains...let's make lots of money. [votes: 7] What did ya say?? Man, you made me lose count!! [votes: 6] Someday all this will be yours. [votes: 5]

Results from Contest # 228 [July 8, 2007 - 244 entries]

		Excuse me - did you say I am NOT going on vacation with you? [votes: 62]	dextersmom
		Don't cha wish your jack was HOT like ME !!!! [votes: 44]	Roxy
		'Jack' Nicholson. [votes: 37]	Pat
	Honorable Mentions Too cool for obedience school. [votes: 34] What makes you think Nationals went to my head? [votes: 20] My future's so bright, I gotta wear shades. [votes: 17] I make this look good... [votes: 17] Single Jack Male seeking Single Jack Female, vaccinations not important. [votes: 16] Jack of all Shades. [votes: 15] Jack-of-all-SHADES. [votes: 14] No autographs please! [votes: 11] Let's do lunch. I'll have my people get with your people. [votes: 11] I wear my sunglasses at night... [votes: 11] Seeking female: must be house broken, 51% white, nice gait....strays need not apply. [votes: 11] If you ain't got these glasses, you ain't got jack. [votes: 8] Jack makes a spectacle of himself for attention. [votes: 8] You can't handle the truth about the cat! [votes: 6] Jackie Oh! [votes: 4] Don't it make my brown eyes BLUE? [votes: 4] I ain't nothin' but a hound dog. [votes: 4] Don't you get tired of looking at such total PERFECTION? [votes: 3] Let's take it outside... [votes: 2] Objects (cats) seen may appear closer than they seem. [votes: 1]

Results from Contest # 227 [July 1, 2007 - 298 entries]

		One of the disadvantages of being a short legged Jack Russell! [votes: 49]	Helen Mason
		Get in my belly... [votes: 41]	skip
		I think I can, I think I can, I think I can... [votes: 30]	Martha
	Honorable Mentions The Spotted Chef !! [votes: 25] No, my instructions clearly specified to put this on the floor... [votes: 24] It's Shake-n-Bake and I helped! [votes: 24] Is this a fat joke? [votes: 22] When will the cat be done? [votes: 20] Can I get a little help here? [votes: 18] Jack the 'Sniffer'. [votes: 16] I'll have mine rare - right now. [votes: 15] Here chicky, chicky, chicky... [votes: 9] Fatal Attraction. [votes: 8] Bacon, bacon, bacon! [votes: 7] I like mine with grey hair and a bushy tail! [votes: 7] Jack realizes that there's a down side to stove top cooking. [votes: 6] 1 For You, 2 For Me. [votes: 5]

Results from Contest # 226 [June 24, 2007 - 224 entries]

		Jack be nimble, Jack be quick, Jack passed out on a big ol' brick. [votes: 93]	Hailey Girl
		One tequila, two tequila, three tequila, Floor!!	Bobbie Jo
		Slumber jack. [votes: 36]	Michelle
	Honorable Mentions When you're really tired, any pillow will do. [votes: 30] Jack the Napper. [votes: 19] Did I get a pillow for Christmas? Noooo, another collar! [votes: 19] Jack listened carefully to the brick for hours, yet he still heard nothing. [votes: 19] Dog Tired. [votes: 19] I feel like Paris Hilton in prison. All I did was bite off the end of the cat's tail!! [votes: 16] This is NOT a Holiday Inn Express!!! [votes: 14] My head is on the chopping block again. [votes: 13] Let sleeping dogs lie. [votes: 13] Dog days of summer. [votes: 11] Mom always said there would be days like this. [votes: 11] Jack on Board! [votes: 9] Jack is finally thinking concrete thoughts! [votes: 9] Play Hard, Rest Well! [votes: 7] I should have waited the 30 minutes after eating before swimming! [votes: 6] Union Break. [votes: 5] I am tired of being 51% white. [votes: 5] A chip off the ol' block... [votes: 4] I love the smell of Brick in the Mornin. [votes: 4] Yeah, I'm probably too hot but I don't know it yet. [votes: 3] This is not as comfortable as it may seem. [votes: 2]

Results from Contest # 225 [June 17, 2007 - 279 entries]

		Hi, I'm Jack Russell, you must be Jack Daniels. [votes: 59]	Tam
		Told you not to bite the lamp cord. [votes: 53]	Herman
		Wow buddy, that must have been one great party! [votes: 41]	Thom
	Honorable Mentions Stuck your head out at the car wash didn't you? [votes: 38] Yes, it was a skunk... anymore dumb questions???? [votes: 36] You short haired Jacks just roll out of bed and look good. It takes a lot of work for me. [votes: 35] Just don't ask... [votes: 23] If Lindsay Lohan was a Jack Russell. [votes: 22] Chased the ole' black cat with the white stripe did ya. Smell you later! [votes: 12] One eyed Jack. [votes: 10] I'm the favorite. Pass it on. [votes: 9] This secret will make your hair stand on end. [votes: 9] Notice: this jack russell terrier has just woken up. do not disturb. may pee on carpet. [votes: 8] Brylcream... a little dab would do you good. [votes: 8] I know I look and smell bad, but you should see the other guy! [votes: 8] Guess which Jack used the name brand dog shampoo! [votes: 8] Do I HAVE to give Aunty a kiss? [votes: 5] MOM!!! Jack's been into your conditioner again! [votes: 4] Tell me again. How did you sneek out? [votes: 4] Before and After. [votes: 3] Go and clean your room. Now! [votes: 1] Out chasing squirrels again Jack? [votes: 1]

Results from Contest # 224 [June 10, 2007 - 277 entries]

		See, I told you the cat was heavier than the muffin. [votes: 98]	Rick and Rox's Mom
		This is their sick way of getting us to take a bath. [votes: 60]	branden
		The 5-second rule still applies...doesn't it??? [votes: 43]	Bailey
	Honorable Mentions If we stare at it long enough, it will come to us... [votes: 33] Her cooking's so bad I was sure it would sink! [votes: 21] It's not worth it, Joe ... there' a plate full of 'em on the table! [votes: 21] Do You Know The Muffin Man?? [votes: 18] Damn Cinnabons. Somebody's gettin' wet. [votes: 18] Double The Pleasure, Double the Fun. [votes: 17] Did it move? I think it moved, yep, it moved! [votes: 15] Is it worth it? [votes: 12] I feel sorry for the cat, but he let go of the muffin. [votes: 10] The silence of the Jacks... [votes: 10] Top o' the muffin to ya! [votes: 8] Trick Or Treat? [votes: 5] Going, going scone! [votes: 5] Everyone outta the pool. [votes: 3] You know Mom's just inside the door with a camera, right? [votes: 3]

Results from Contest # 223 [June 3, 2007 - 373 entries]

		You think you're going without ME--you don't know JACK!! [votes: 77]	Linda
		You are not leaving me with Grandma, again! [votes: 69]	Tammy
		What happens at Nationals...Stays at Nationals... [votes: 30]	SpitFyre
	Honorable Mentions Hit the Road Jack...! [votes: 24] How to get your JRT X-Rayed for free! [votes: 22] No Jack Left Behind! [votes: 20] Are we there yet??? [votes: 20] All my bags are Jacked...I'm ready to go... [votes: 19] I'm going to DISNEY WORLD!!! [votes: 16] Jack Pack [votes: 15] Some day my mom will buy me a travel crate. [votes: 14] Jack the Tripper! [votes: 14] What the?? Hmm, last thing I remember is closing my eyes, then a zipping sound... [votes: 14] Have Jack, will travel. [votes: 11] We all come with our own baggage! [votes: 10] The best traveling companion anyone can have. [votes: 9] Do you think they will serve peanuts on this flight? [votes: 6] Will I fit in the overhead bin? [votes: 6] Homeward Bound [votes: 6] Curses foiled again. [votes: 6] Hopefully my people remember to check this as a carry on this time. [votes: 5] I hate flying coach... [votes: 4] I've always wanted to see France. [votes: 3] Time to pack for the next terrier trial. [votes: 3] How much extra for carry-on ticket? [votes: 1]

Results from Contest # 222 [May 27, 2007 - 304 entries]

		How many Jacks does it take to flood the bathroom? [votes: 57]	Charlotte
		Do we want "C"ookies or "H"amburger? [votes: 53]	Barb Eales
		If I can reach that razor, we'll shave that cat while he sleeps! [votes: 52]	sam's dad
	Honorable Mentions I've seen them... they stand here and the indoor rain comes. [votes: 49] JACK-CUZZI. [votes: 49] Trust me. I know what I'm doing. [votes: 42] It was horrible! NEVER turn this lever to the right. [votes: 39] Curiosity Cleaned the Jack. [votes: 32] I double dog dare you! [votes: 22] Who needs a groomer, we can do this ourself. [votes: 14] Hey I wonder what this does? [votes: 11] You got the stopper in? How long do you think it will take to fill the room up? [votes: 7] If you start singing, I'm outta here. [votes: 6] Darn! Still too short to reach the faucet! [votes: 6] Gonna wash that Jack right outta my hair! [votes: 5] Group shower, I saw this once in a late night movie! [votes: 5] No shower for me thanks, I have conformation next week! [votes: 1]

Results from Contest # 221 [May 20, 2007 - 267 entries]

		Are you sure this is a baby tooth? [votes: 45]	Daniel
		Jack's reinactment of "Lady and the Tramp" was not going as planned... [votes: 38]	Erin
		No, I'M taking YOU for a walk. [votes: 38]	Arthur
	Honorable Mentions Everybody LIMBO! [votes: 32] Jack and Jill devise a plan to tie up the cat. [votes: 31] mine mine mine mine [votes: 29] You said "no strings attached"! [votes: 24] Oh Yeah! That's got it. Thanks man, that piece of cat has been stuck in there for days! [votes: 22] Hey, we agreed what mine is mine and what yours is mine. [votes: 19] This is BORING, let's go find a squirrel. [votes: 17] I'm really at the end of my rope dear. [votes: 13] Time out! I'm caught on something... [votes: 10] oops..I think I swallowed it! [votes: 7] This looked better in the movie. [votes: 7] It's going to be a long night. [votes: 6] Field day at obedience school. [votes: 6] Mom went on a vacation, and all she brought back was this rope...burp...with a cat attached. [votes: 5] Sure would be nice to have thumbs eh? [votes: 4]

Results from Contest # 220 [May 13, 2007 - 211 entries]

		Spot, Spot, Spot and their other brother, SpotLESS. [votes: 64]	Pat
		We give this food two tails up. [votes: 55]	hwood
		You idiot! That glue didn't make us "super!" [votes: 54]	Daniel
	Honorable Mentions X marks the Spot!! [votes: 28] We're losing him doctor! [votes: 25] I know we can do it if we put our heads together! [votes: 24] Hey guys, last one to finish is a cat lover! [votes: 24] JRT Pinwheel Dinner - Eat clockwise. [votes: 17] A Meeting of the Minds. [votes: 16] Home cookin'! They'll never recall this!!! [votes: 16] You realize 6 months from now, we won't be able to do this... [votes: 13] You two get the arms. We got the legs. [votes: 9] Stop! Stop! My spots are in there! [votes: 9] Last one to eat loses his spots! [votes: 5] Only surgery could separate them, or the well placed cat. [votes: 4] What's for dinner? [votes: 4]

Results from Contest # 219 [May 6, 2007 - 348 entries]

		You lied in your on-line profile.. didn't you? [votes: 51]	Jack 1
		Yes, I ordered my steak rare, but I didn't expect this! [votes: 38]	Megan R
		To tip, or not to tip, that is the question. [votes: 32]	swtmdmboo
	Honorable Mentions This pasture isn't big enough for the two of us. [votes: 32] Less than 50% white...you may be excused from the ring. [votes: 31] You're the biggest broken coat I've ever seen! [votes: 30] ..I said shooo!!, beat it!!........this is my turf steak boy!! [votes: 26] My milk shake brings all the jacks to the yard... [votes: 24] Whoa, what did I just step in? [votes: 20] Get in my belly! [votes: 18] Ima gonna chase ya', then ima gonna eat ya'! [votes: 17] So much cow... so little time [votes: 15] And this one time in obedience camp... [votes: 14] Wow mom went all out with dinner!! [votes: 8] Didn't we have this same conversation yesterday? [votes: 8] Go on .. keep off the grass! [votes: 6] He ain't heavy, he's my brother! [votes: 5] Jack had to confess that he was lactose intolerant [votes: 5] Somebody bring me a pail... [votes: 4] That's it! I want a pay raise! [votes: 2]

Results from Contest # 218 [April 29, 2007 - 415 entries]

		I don't know why they call 'em blinds, I can see right through them. [votes: 66]	Bailey
		OK the fly is dead. [votes: 49]	Lori Wells
		How much is that doggie in the window? [votes: 38]	Pat
	Honorable Mentions Heeeree's Johnny! [votes: 37] I hate to interrupt, but this is important... [votes: 33] OOPS, wrong basement. [votes: 26] Dang, this looks easy when the cat does it! [votes: 17] Love is blinds. [votes: 16] No thanks, sorry, I'm just window shopping. [votes: 13] Heh, the neighbor's cat doesn't want to play anymore. He just lays there... [votes: 13] Lets just say this is the result a long night and 1 too many doggy biscuits. [votes: 12] Avon Calling! [votes: 11] I knew this was a bad idea. [votes: 11] You know for a few pennies more, an elizabethan collar would work. [votes: 10] I think Mom is going to be very mad at me. [votes: 10] The doggie door was in use. [votes: 10] Blinded by his own curosity, Jack just had to peek! [votes: 10] Oh ya....I'm watchin you.... [votes: 9] I know what you did last summer. [votes: 9] Today is so not my day! [votes: 9] Heh, why are you sitting on my porcelain water bowl? [votes: 8] What a beautiful mess i made. [votes: 7] Who put this shade in my doggy door? [votes: 7] Wait a minute....am I coming or am I going? [votes: 2]

Results from Contest # 217 [April 22, 2007 - 285 entries]

		Jumpin Jack Splash. [votes: 74]	Christa
		Dang! I hate it when they hook it up to the air hose. [votes: 67]	Shelby GT
		I'm Ready!!!!! Hit the switch... [votes: 34]	Donna4Jacks
	Honorable Mentions Hose your daddy? [votes: 26] Hit the remote, I'm on pause! [votes: 24] You've watered your last lawn... [votes: 23] Die alien, die. [votes: 21] Ha HA!!! You will NEVER Bathe me!!! [votes: 19] You mark my territory, and I'll mark yours! [votes: 18] Jack be nimble, Jack be quick. [votes: 15] Yeow!!! Cold water! [votes: 15] Man, this one's gonna hurt... [votes: 13] Uh oh...no water! [votes: 11] What does a guy have to do to get a drink around here? [votes: 9] Jack was very confused by the invisible water. [votes: 9] This landing looks like it might be painful - Houston we have a problem! [votes: 8] Leap of faith. [votes: 6] Don't leave me hanging in a situation like this! [votes: 5] Waiting for the geyser. [votes: 4] Matrix. [votes: 4] What a fun way to get a bath! [votes: 3] Watering, SPOT! [votes: 1]

Results from Contest # 216 [April 15, 2007 - 358 entries]

		Somebody moved my doggy door...not funny. [votes: 75]	anonymous
		Who says white dogs can't jump? [votes: 64]	RileyBean
		Gotta go, gotta go, gotta go right now. [votes: 41]	Nancy
	Honorable Mentions Jump up, bark at the mailman. Jump up, bark at the mailman. Jump up, bark at the mailman. [votes: 37] Jumpin' Jack! [votes: 25] Don't leave meee!!! [votes: 24] Mom's home!! [votes: 23] I can't see jack out of this little window. [votes: 19] The Mail Man is Here! The Mail Man is Here! [votes: 17] Mom, come quick, there's a man with a big cardboard check outside. [votes: 17] Pizza's here! [votes: 14] Has anyone let the dog out this morning? [votes: 11] It's Dominos, open the door. [votes: 9] Can I see some ID, please? [votes: 9] yoo hoo, Mr. Postman... [votes: 8] What's the password? [votes: 8] She's here! Everybody hide! [votes: 8] Wash on delicate, hang to dry. [votes: 8] Jack be nimble... [votes: 7] Bark, Who goes there??? [votes: 6] There's a girl scout at our door!....order more cookies!! [votes: 5] Heeeeere's Johnny! [votes: 4] Mom told me not to let stangers in while she was gone. [votes: 1]

Results from Contest # 215 [April 8, 2007 - 276 entries]

		If anybody asks, we did NOT do it, we were taking naps.... [votes: 67]	Dusty's Mom
		Come on!! You run like a Cat! [votes: 58]	Mercedes
		If you can't keep up with the little white dogs, stay on the porch!	Divot
	Honorable Mentions Run Forrest! Run!!! [votes: 39] I think I stepped in something. [votes: 27] You put your left leg in.. you put your left leg out... [votes: 26] Jacks new jogging partner is a little rusty... [votes: 26] Dude! Mom's gonna kill you when she see's how muddy you got! [votes: 21] Don't touch me with those muddy paws--I'm wearing WHITE! [votes: 21] And then she said I was insensitive! Do you think I'm insensitive? [votes: 21] Anything you can do I can do better! [votes: 18] You got any last requests before you eat my dust? [votes: 17] JRT trials are second on the left, straight ahead for 1 mile. [votes: 14] Thelma and Louise. [votes: 10] Take a look at my girl friend, she's the only one I got. [votes: 10] When we get home, you wanna rip that perfectly good toy that mom bought us yesterday up? [votes: 9] Run, run, now feel the burn! [votes: 8] Happy Feet. [votes: 6] Lets Do Some Hunting! [votes: 4] Who let the dogs out? [votes: 4]

Results from Contest # 214 [April 1, 2007 - 306 entries]

		First I'm gonna de-squeak ya, then I'm gonna eat ya. [votes: 74]	Bailey
		Who's Your Daddy? SAY IT !!!! SAY IT !!!! [votes: 35]	Roxy
		Beef...It's what's for dinner... [votes: 35]	SpitFyre
	Honorable Mentions Don't you udder another word! [votes: 28] All toys must die. [votes: 27] My Precious!! [votes: 24] Mad Cow, Mad Cow! [votes: 22] Now I have you, you cow-ard! [votes: 21] Resistance is futile. [votes: 17] Jack is lactose intolerant. [votes: 16] Snap plastic leg (part A) into body (part B) and your new cow toy is ready for hours of enjoyment! [votes: 14] Where's the beef? [votes: 13] Any last words? [votes: 12] Die before I kill you. [votes: 12] Just wait 'till they fire up the grill. [votes: 9] Do you know the muffin man? [votes: 7] Hey...this one's out of milk!! [votes: 6] Any last requests? A blindfold, maybe? [votes: 5] The cow was mislead on how the milking was done. [votes: 4] Who's the dummy now? [votes: 4] What a non creative caption! [votes: 1]

Results from Contest # 213 [March 25, 2007 - 248 entries]

		That St. Bernard next door must be getting another bath. [votes: 46]	Dillon
		Jack contemplates how he will attack each and every one... [votes: 41]	Julz
		So many bubbles so little time. [votes: 40]	Carol
	Honorable Mentions I don't think the weatherpeople saw this one coming... [votes: 37] If only we could open the door. [votes: 30] Look.....at all those balls. [votes: 27] Sorry kid... bubbles give me gas. [votes: 24] This is way better than snow. [votes: 22] I don't think we're in Kansas anymore, Toto!! [votes: 18] One day my son, all this shall be yours! [votes: 16] Don't worry kid, when you get older I'll teach you how to play with those. [votes: 13] After they clean you with the soap bubbles, they put a diaper on you! [votes: 12] Yeah, I want to go outside too. You share my pain, brother. [votes: 12] Cheap entertainment. [votes: 11] They are so pretty... I wonder what they TASTE like! [votes: 10] The sky is falling, the sky is falling! [votes: 9] How many do you think there are? [votes: 6] Connect the dots. [votes: 5] It's the most beautiful sight I've ever seen! [votes: 5] How many of those do YOU see...? [votes: 4]

Results from Contest # 212 [March 18, 2007 - 321 entries]

		A little ditty about Jack and Diane. [votes: 47]	Amy C
		Are we there yet? [votes: 44]	KaiserJack
		I know she put the groceries back here. [votes: 37]	Jdurbin
	Honorable Mentions My Jack is smarter than your honor student! [votes: 35] He ain't different, he's my brother. [votes: 29] You gonna puke? I'm gonna puke. [votes: 27] Say hello to my little friend. [votes: 24] Mutt & Jack. [votes: 22] What are you guys doing in the trunk? [votes: 19] Isn't it fun making faces at the cars behind us? [votes: 19] I told you the cat could run really fast... [votes: 15] Seat Belts ! We don't need no stinkin' seat belts! [votes: 15] Oh-oh...Who's drivin'?! [votes: 12] Whatever it is, we didn't do it!! [votes: 12] Roadtrip! [votes: 11] I think I'm going to be car sick. [votes: 8] Stop tailgating me, man!!! [votes: 6] Are you thinking what I'm thinking? [votes: 6]

Results from Contest # 211 [March 11, 2007 - 321 entries]

		Jack and a spare. [votes: 96]	Susan
		"Lo-Jacks" - A Vehicle Recovery System. [votes: 62]	Terp's Mom
		Those suitcases won't be necessary - just our bowls, thank you. [votes: 34]	swtmdmboo
	Honorable Mentions Tire jacks. [votes: 33] Jacks are always good in case of an emergency. [votes: 28] Nope, no junk in this trunk! [votes: 21] Open carefully, contents under pressure. [votes: 20] BABY! I can explain. [votes: 14] Honey, does our auto insurance cover bite marks & car jackings? [votes: 14] Are we there yet? [votes: 13] Spring Break: Jacks gone Wild. [votes: 10] ROAD TRIP [votes: 10] 125 Horsies up front, two doggies in back. [votes: 10] Trunk Drivers. [votes: 10] Yeah, we're bootylicious. [votes: 9] Luggage? There's no room for luggage in here. [votes: 9] We've been very bad... [votes: 7] This sure beats sticking our heads out the window! [votes: 7] Modern-day fox hunting... [votes: 6] I heard the hotel rooms in Europe were small, but geez! [votes: 4] Free at last. [votes: 4]

Results from Contest # 210 [March 4, 2007 - 357 entries]

		Lumber jack! [votes: 48]	JJ
		Hi, I am a single male Jack who enjoys long walks, good weather and nice trees. [votes: 47]	Paul M
		Don't worry. I'll be here when that cat comes down. [votes: 41]	TimT
	Honorable Mentions 2007 Sexy JRT Calender [votes: 40] Jack's senior picture. [votes: 28] Sooner or later, it has to come down. [votes: 25] Keep on walking buddy, nothing to see here. [votes: 20] When I stand like this does it make me look fat? [votes: 20] My tree... This is my tree... [votes: 19] Can't a guy get a moment of privacy here? [votes: 17] I like long walks on the leash and a food bowl for two. [votes: 16] You hide and I will seek. [votes: 12] Work it girl! Strike a pose! [votes: 12] What goes up, must come down. [votes: 12] Give me an hour, I'll turn this tree into a beautiful deck. [votes: 11] ...barking up the right tree. [votes: 11] This tree is all bark and no bite!! [votes: 10] So many trees, so little time. [votes: 9] This should get me on the cover of True Grit! [votes: 8] Now this is my kind of urinal! [votes: 7] Sorry, try the next one... this one's occupied. [votes: 5] ah no ... someone been here before! [votes: 1]

Results from Contest # 209 [February 25, 2007 - 333 entries]

		5 jacks and a jill. [votes: 59]	swtmdmboo
		Dora's Last Exploration. [votes: 53]	Nick Shadursy
		You pull her to safety, I'll check her pulse. [votes: 50]	Dianna Gardner
	Honorable Mentions CSI: Jack Russell Terrier. [votes: 34] Dora gets explored! [votes: 29] Bad pups, bad pups, whatcha gonna do, whatcha gonna do when they come for you? [votes: 28] I don't like her. She seems fake. [votes: 27] Let's crate 'er! [votes: 26] Dora the Explorer meets Jack the Mauler and his cousins, Vinny, Pete, Frank and Paulo. [votes: 23] How do we know for sure she's not one of the "Others"? [votes: 19] Cabbage Patch Jacks! [votes: 16] Dora is no longer the Explorer. [votes: 16] Tastes like pollo! [votes: 15] Jack the GRIPPER! [votes: 15] Silence of the Dolls. [votes: 14] OH Boy - finally somebody our own size to play with. [votes: 13] Guys and Doll. [votes: 13] She'll never make it in Conformation. [votes: 7]

 

Results from Contest # 208 [February 18, 2007 - 259 entries]

		Punxsutawney Jack. [votes: 111]	Kathy
		Be Very Quiet, we're hunting Wabbit! [votes: 60]	Matt Haring
		Nope, Not in Florida Yet. Keep digging. [votes: 47]	Donna4Jacks
	Honorable Mentions I'm not coming out until you apologize. [votes: 33] The ground hog sleeps with the fishes. [votes: 24] Had to get away from the wife and kids for awhile. [votes: 20] I'm all for Global Warming. [votes: 18] Out last, Out wit, Out play. [votes: 15] Now is the winter of my discontent... [votes: 15] Ah! light at the end of the tunnel! [votes: 14] Occupied. [votes: 12] Baby it's cold outside!! [votes: 11] The weather outside is frightful, but here its so delightful. [votes: 11] How to Housebreak Your Dog in Just One Hour. [votes: 10] Closer Closer just a little closer. [votes: 8] Go to the ground winter edition. [votes: 7] Snow Day! [votes: 6] Prey goes into hole, Jack goes into hole, our JACK, farewell and adieu to the wee little PREY. [votes: 4]

Results from Contest # 207 [February 11, 2007 - 452 entries]

		Can you hear me NOW? [votes: 93]	steff
		Hey there pussy cat, woahhh woaahhhh wooaahh! [votes: 45]	Rammer
		CCCCCCCAAAAAAAATTTTTTTT !!!!!!!!!! [votes: 39]	Helen
	Honorable Mentions Get in my belly!! [votes: 32] Ha ha ha ha!!!! Oh, sorry. You're probably tired of the cat jokes. [votes: 28] If you look reaaallly close you can see your brother. [votes: 28] Sometimes I crack myself up. [votes: 20] HOW MANY TIMES do I have to tell you??!!....WIPE...YOUR...PAWS!!! [votes: 19] Dogs rule, cats drool!!! [votes: 17] Does this tooth look infected to you? [votes: 16] You can't handle the truth! [votes: 15] I've heard that you can shatter cats by singing the right note. [votes: 15] It's a no from me, Sorry, you are not going to Hollywood. [votes: 14] I want BACON!!! [votes: 13] I think the cat is ignoring me! [votes: 8] Cat got your tongue? [votes: 8] ...and you play the part of Little Red Ridinghood. [votes: 7] So, Simon, Paula.....what do you think? [votes: 6] It was just a-ight for me dawg. [votes: 5] Make the cat stop. [votes: 3] Pray. My Dear Prey. [votes: 3]

Results from Contest # 206 [February 4, 2007 - 388 entries]

		Jack Frost [votes: 98]	Pat
		When you said it was knee deep, I thought you meant MY knees! [votes: 48]	Thom Derry
		Where am I? This rabbit hole started in Florida. [votes: 46]	Sierra
	Honorable Mentions Never thought I'd be glad to be neutered... [votes: 38] SERIOUSLY!!! It's snowing, I'm done going potty. LET ME IN!!!! [votes: 36] I went to ground and came up in Alaska. [votes: 28] Jack-sicle [votes: 28] If I lick my nose, will it stick? [votes: 23] I'm making yellow snow right now. [votes: 22] Chili dog! [votes: 19] Um...could someone call me a St. Bernard? [votes: 17] Ice Ice Baby [votes: 14] Global Warming? What Global Warming? [votes: 13] And they wonder why we are hard to housebreak. [votes: 12] Can you see me now? [votes: 12] Baby it's cold outside. [votes: 9] 6 more weeks of winter??? REALLY???? [votes: 9] I'm thinking Cancun. [votes: 9] Thinking Warm Thoughts !! Thinking Warm Thoughts. [votes: 9] I hope that chicken noodle soup is ready. [votes: 8] Let it snow, let is snow, let it snow. [votes: 7] Hey, we like to dig INTO stuff, not OUT of stuff! [votes: 6] Definitely 51% white. [votes: 6] Al Gore, I'm coming for you!!!! [votes: 5] Periscope Up! [votes: 5] Frigid dare. [votes: 4] Peek...a choo! [votes: 4] Look mom no body. [votes: 4]

Results from Contest # 205 [January 28, 2007 - 359 entries]

		Hush little russell don't say a word, Momma's gonna buy you a flying squirrel! [votes: 52]	Roxy
		Don't make me turn this stroller around!!! [votes: 43]	Megan Rees
		Look at me when I am talking to you. [votes: 37]	Jack
	Honorable Mentions Don't make me call your father! [votes: 28] I think somebody needs a "time out". [votes: 26] Are you sure he's mine? [votes: 23] I'm old enough to be on a leash mom! [votes: 22] This isn't mine is it? I want a paternity test. [votes: 20] NO mommy no, I don't wanna go the vet. [votes: 20] Yuk! Mom, you have doggy breath! [votes: 20] Ok...once more around the block - then we go home. [votes: 18] What did you say to me? [votes: 15] Don't you eyeball me boy! [votes: 14] A visit from Nanny 911. [votes: 13] I don't like it either, but Consumer Reports says it's safe. [votes: 11] It wasn't funny yesterday and it's still not funny today! [votes: 10] Don't be a baby, a spit bath never hurt anyone. [votes: 8] Rosemary's Baby. [votes: 7] ... and when they come to claim the seat just growl....with conviction. [votes: 7] Jack shows his nurturing side. [votes: 6] Please... I beg you...do it for your Mother...STOP BARKING!!! [votes: 6] You're suppose to push from the back, Jack!! [votes: 6] How bad do you want to be in the fraternity? [votes: 4]

Results from Contest # 204 [January 21, 2007 - 275 entries]

		Lumber Jacks. [votes: 81]	Bailey
		When we get to shore, remember "I" found it first! [votes: 48]	Thom Derry
		Cold water, a nice stick, my best buddy....LIFE IS GOOD!!! [votes: 46]	Jim Long
	Honorable Mentions Let's swim real fast and trip the duck. [votes: 41] This counts as our baths, right??? [votes: 36] We always STICK together! [votes: 28] How did I ever let you talk me into this...i just wanted to chase the squirrels. [votes: 27] United We Swim -- Divided We Sink. [votes: 19] You keep saying dog paddle, dog paddle!!! What do you think I am doing? [votes: 18] I'm tired of filming this stupid Disney movie. [votes: 17] Dog-Paddling. [votes: 16] I can't believe I got the short end of the stick! [votes: 15] We're gonna need a bigger boat. [votes: 12] Are you pulling or pushing? [votes: 12] When the Captain says "Don't touch that" he means it !!!! [votes: 11] Why is this stick so important? [votes: 10] Uh, I don't know about this flotation device, how much further to land? [votes: 6] I'm thinking "Pappillon". [votes: 6] Job competition. [votes: 4] It may not be mud, but we can roll in the dirt afterwards. [votes: 3] Wanna split it...? [votes: 2] Were just going with the flow. [votes: 1]

Results from Contest # 203 [January 14, 2007 - 268 entries]

		I still don't understand why they put a DOG BED on my couch. [votes: 111]	Donna4Jacks
		Another $39.99 well spent! [votes: 72]	trevor
		Bed for sale - very soft - no view. [votes: 35]	JO
	Honorable Mentions If it's so comfortable - You sleep in it! [votes: 31] Thinking outside the box. [votes: 29] Always go for the window seat. [votes: 26] Nope, not after the cat slept in it. [votes: 23] How do you expect me to keep an eye on things from down there? [votes: 23] Just in case I fall. [votes: 19] I like livin' on-the-edge! [votes: 17] Snoopy syndrome strikes again. [votes: 14] Anywhere Jack lays his head is his home. [votes: 13] Cat smell, cat smell, jack no sleep in cat smell. [votes: 9] Example of separation anxiety. [votes: 8] Bunk beds. [votes: 7] Another failed idea! [votes: 5] Don't be fooled by imitations. [votes: 5] Sleeping in the loft. [votes: 4] I missed. [votes: 3] I do all my own stunts! [votes: 3]

Results from Contest # 202 [January 7, 2007 - 393 entries]

		Russell, Jack Russell. [votes: 126]	Sindy
		Every girl's crazy about a sharp dressed jack. [votes: 41]	rebecca91
		I'm bringing SEXY back! [votes: 33]	Riley B
	Honorable Mentions We meet again, Mr. Bond. [votes: 30] Frankly my dear, I don't give a damn. [votes: 26] I'll take my kibble shaken... not stirred. [votes: 24] I'm too sexy for my shirt. [votes: 23] All dressed up with nothing to chew. [votes: 20] My name is JACK and i will be your waiter tonight. [votes: 20] The difference between me and you is, I make this look GOOD. [votes: 19] Simply irresistible! [votes: 10] I doo, I doo, can I lick the bride? [votes: 8] Did you say sauteed feline? That sounds good, I'll have that! [votes: 8] Jackolicious [votes: 6] I do, I don't, I do, I don't...I can't do this! Wait!! Isn't there going to be cake? I DO!!!! [votes: 6] That was one heck of a party! I think I kissed the cat... [votes: 6] These confirmation awards ceremonies are getting a little to formal... know what I mean? [votes: 6] Where the ladies at? [votes: 5] Got my tie and tails... [votes: 5] One of my better prom dates! [votes: 4] For better or worse, for richer or poorer... [votes: 3] A mischief in disguise. [votes: 3] My bowl is a black tie affair. [votes: 2] By Invitation Only [votes: 1]